CRISPR/CAS9 FAQs

Yes, the NGG is located immediately next to the 3′ end of the 20bp sequence in the genome. However NGG is not included in the guide RNA sequence.

The 20bp target-specific sequence should precede NGG (PAM). Please BLAST the seed region (8-14 bp PAM-proximal) of the 20bp target sequence to make sure it’s unique along the genome to guarantee its specificity.

You can blast your target sequences. If the off-target sequences don’t have the PAM (NGG), then they won’t be targeted by CRISPR/Cas9. You also want to choose target sequences with mismatches in the 8-14 bp at the 3’ end of the target sequences. This way, the off-target issue can be decreased dramatically. For therapeutic purpose, you can use Cas9 nickase which only cuts one strand.

Due to the un-predicable nature of gRNA, we recommend 3 and more gRNA targeting sequences to be designed to make sure that at least one targeting sequence will provide efficient cleavage.

Cas9 cleaves at 3 bp away from the 3’ end of the target sequence in the genome.

The targeting sequences could be located in either exon or intron in the genome; the cDNA sequences only contain the exons. CRISPR/Cas9 will target the genomic sequence, then genome editing will be achieved.

For making gene knockout mice and genome editing in other organisms, such as Drosophila, some researchers do microinjection of gRNA and Cas9 mRNA into cells.

You can use pCas-Guide-EF1a-GFP to enrich transfected cells since GFP is also expressed. We also have pCas-Guide-EF1a-CD4 vector; you can use anti-CD4 antibody beads to enrich transfected cells. Alternatively, you can transfect a plasmid with a selection marker and select the cells. Lenti vector can be used and integration-deficient lentivirus can be produced using the special integration-deficient lenti packaging kit (cat# TR30036); the lenti CRISPR vectors can be delivered into hard-to-transfect cells, but not integrating into the host genome.

You can use series of dilution or cloning cylinders to isolate single cell colonies.

The donor template DNA is not preferred to be linearized as this will increase random integration.

For mutations, you can do genomic PCR and sequence it. If you do gene knockout, the selection marker in the donor template DNA will help the selection. If no donor DNA for gene knockout out, then genomic PCR and sequencing to confirm indels. If necessary, you can isolate individual cell colonies for introduction of specific mutations and other genome editing applications. You can do WB for gene knockout after isolating single cell colonies.

NHEJ repair works in non-dividing cells; HDR is not active in non-dividing cells.

CRISPR/Cas9 double-strand cleavage is very efficient. If just using CRISPR/Cas9 vectors to introduce indels, if transfection efficiency is high, more biallelic knockout can occur. In the presence of donor DNA, since homologous recombination may be a limiting factor, some cells contain monoallelic knockout and some cells contain biallelic knock out.

Yes, We do have Cas9 antibody (cat# TA190309). In our CRISPR/Cas9 vectors, Cas9 has a C-terminal Myc-DDK tag. DDK is the same as Flag; OriGene’s anti-DDK antibody (SKU TA50011-100).

You can use a scramble control, pCas-Scramble, SKU GE100003, or pCas-Scramble-EF1a-GFP, SKU GE100021.

You can do both. You can inject mRNA (gRNA and Cas9 mRNA) or plasmid DNA (target sequence cloned pCas-Guide) into the zygotes or ES cells.

You can do multiplexes using CRISPR/Cas9 system. You can co-transfect the gRNA vectors or co-inject several guide RNAs into your cells; so you will achieve multiple gene disruption or genome editing. The limit could be transfection efficiency.

For screening purpose, for short term, integration of Cas9 into the genome for 2 weeks does not affect cells. You can also use the integration-deficient lenti packaging kit to produce lentivirus that won’t integrate into the cellular genome, acting just like plasmid.

Yes. The 20 bp target sequences only need to precede NGG.

Yes, depending on the cell line and the gRNA sequences.

In general, the genome editing efficiency of CRISPR/Cas9 is similar or higher than TALEN. However, CRISPR/Cas9 is much more simple and easy to do. You will need to engineer the protein to recognize new DNA sequence in TALEN system, while CRISPR/Cas9 is RNA based.

5’-ACGATACAAGGCTGTTAGAGAG-3’

5’ GCACTACCAGAGCTAACTCA 3’

Yes, you can order gRNA cloning service and donor vector service.

The pLenti vector is a third generation lentiviral vector and it is the safest lenti-viral vector because both LTRs are truncated. Please contact the biosafety office at your institution prior to use of the pLenti vector for permission and for further institution-specific instructions. BL2/(+) conditions should be used at all times when handling lentivirus. All decontamination steps should be performed using 70% ethanol/1% SDS. Gloves should be worn at all times when handling lentiviral preparations, transfected cells or the combined transfection reagent and lentiviral DNA.

The 3rd generation lentiviral vectors are safer than the 2nd generation vectors. The 3rd generation packaging systems express gag and pol from one packaging vector and rev from another. The 3rd generation packaging systems DO NOT express tat (Trans-Activator of Transcription).

Yes, a second generation packaging system should work with OriGene’s third generation pLenti vectors although we have not explicitly tested this. You can use OriGene’s high efficient third generation lenti-packaging kit (cat# TR30037) for pLenti-vectors.

M13 forward primer, 5’ CGCCAGGGTTTTCCCAGTCACGAC 3’

Without donor template DNA, the double-stranded break will be repaired by NHEJ; unpredicted indels will be introduced. You will screen the deletions/insertions that cause frame shift. With donor DNA, you will get desired insertion/deletion/mutations. With donor DNA, you will have mammalian selection.

600-1000 bp left or right homologous arms should work for HDR mediated repair.

Please see the downloadable validation data at https://www.origene.com/products/gene-expression/crispr-cas9

Different splice variants of a gene are generated from the same pre-mRNA, splicing at different locations. When we design target sequences to knockout all the splicing forms of a gene, the target sequences are located around the start codon, ATG, of the longest splice variant. The 3’ end of the left homologous arm in the donor vector is right upstream of the start codon ATG. After inserting a donor selection cassette, all of the splicing variants are not expressed.

If you isolate single cell colonies, in some cells gene knock-out may occur only in one allele; in some cells gene knock-out may occur in both alleles. If you only have monoallelic knockout and you want to get biallelic knockout, you can order another donor vector containing a different mammalian selection marker, such as blastocidin or neomycin resistant marker. Make sure the other allele is intact as it can be targeted and repaired via NHEJ; confirm with genomic PCR and sequencing. OriGene has both functional cassettes. You can do the knockout procedure again with the new donor vector to target the second allele (one allele is already targeted and replaced with GFP-puro cassette). Alternatively, you can use Cre to flox out the puro cassette from your edited cells and use the same donor vector from the knockout kit and do the knockout again to target the second allele.

tGFP-integeration_3R; TAGGTGCCGAAGTGGTAGAAGC

KN2.0 is designed based on targeted genome editing technology (CRISPR-Cas9). Target specific gRNA will cut the genome, then the donor DNA containing selection cassette will be integrated at the cutting site via NHEJ (non-homologous end joining) mediated repair mechanism. The donor cassette can be integrated at forward or reverse direction. Most gene knockout are bioallelic, one allele has donor integration, the other allele has indels (insertion and deletion).

Although homology directed recombination (HDR)-mediated gene knockout/knockin is well established, it cannot necessarily be applied in some cell types and organisms with low HDR efficiency. CRISPR KN 2.0 is specifically designed to provide a universal solution for gene knockout needs in every cell type and organism. Studies carried out in house and by collaborators show that CRISPR KN 2.0 is highly efficient and render improved knockout rate.

KN2.0 has successfully tested in HeLa, HEK293T and MIA PaCa-2 (a human pancreatic carcinoma cell line) cells.

Two possibilities. 1. The gene is an essential cell survival gene, so constitutive gene knockout can not be tolerated. Conditional knockout is needed. 2. Transfection efficiency is too low. Transfection optimization or selecting different transfection method is needed, such as electroporation.

Theoretically, KN2.0 can be used for embryo microinjection to generate transgenic animal model. However, this has not been tested in our facility and optimization is warranted.

If your target gene is essential for cell survival, you might not be able to get constitutive gene knockout. Conditional gene knockout may be needed.

CRISPRa/CRISPRi is an RNA-guided genome expression regulatory tool, which was devised based on the CRISPR-Cas9 vector (Qi et al. 2013). 2 mutations were introduced into Cas9 to silence the nuclease activity (called as dead Cas9 or dCas9). dCas9 can be recruited by gRNA to the target genomic loci but cannot cut the target DNA. dCas9 is used as anchor to recruit fusion partner-protein to the targeted promoter. In CRISPRa, activating factors like VP64, VPR are fused with dCas9, while in CRISPRi, inhibitory factors like KRAB, MeCP2 repressive domain are used.

Our engineered CRISPRa SAM belongs to the second generation of the CRISPRa family, which was originally reported by Dr. Feng Zhang’s lab (Konermann et al. 2015). SAM stands for Synergistic Activation Mediator. The CRISPRa vector is an all-in-one vector, containing gRNA cloning sites (gRNA modified with MS2 RNA aptamers in the loop) and the expression of dCas9-Vp64 fusion protein. Another vector, called CRISPRa enhancer, expresses the co-activator MS2-P65-HSF1, which can be recruited by the MS2 structure of the gRNA scaffold and then synergistically activate gene expression with dCas9-Vp64.

Our CRISPRi system is engineered to fuse dCas9 with dual repressive domains, KRAB domain and MeCP2 repressive domain, which has shown stronger inhibition effects compared with classical CRISPRi-KRAB system (Yeo et al. 2018).

Our CRISPRa SAM and CRISPRi system keep the same PAM (protospacer-adjacent motif) specificity as wildtype Cas9 (ie, -NGG). However, our gRNA design is optimized for CRISPRa and CRISPRi. According to the publications (Horlbeck et al. 2016), CRISPRa gRNA within the region from -550bp to -25bp (distance to TSS), and CRISPRi gRNA from -25bp to +500bp (distance to TSS) show best effects. Each gene specific CRISPRa-SAM activation kit contains 3 sgRNAs selected from this qualified pool designed using our proprietary algorithm.

The effects of CRISPRa are affected by multiple factors, including transfection efficiency, sgRNA sequence specificity, and chromatin accessibility. We recommend to first optimize your transfection experiment according to your specific cell type and reagents. Besides sgRNA sequence specificity, CRISPRa function is also impacted by the accessibility of the target DNA (Horlbeck et al. 2016). The factors including nucleosome occupancy and chromatin structure can influence the reach of sgRNA and dCas9 to its target DNA. In addition, based on our experiments, the highly-expressed genes (such as MYC in HEK293T) won’t show a significant response to further stimulation from exogenous CRISPRa SAM system.

When designing gRNA, select gRNA sequence with less or no off-targeting using sequencing blast. It has been reported that CRISPR-fusion protein-related products can increase off-targeting issues from the nonspecific binding of the fusion proteins (Zhou et al. 2019). To offset these effects, you can use scrambled sgRNA as negative control in your experiment.

Due to the unpredictable nature of sgRNA, we recommend designing 3 sgRNA against your target genes. In our CRISPRa activation Kit, 3 gene specific sgRNA, scrambled sgRNA, and CRISPRa-Enhancer are provided. In addition, it has been observed that the co-transfection of 3 sgRNA can be more potent in stimulating their target genes (Chavez et al. 2016).

In cells of successful knockout event, new junctions are created due to the integration of the selection cassette. Primers spanning the new junctions are unique to the knockout cells. OriGene provides a diagram for designing 2 pairs of primers around the junctions. Please go to page 7 on CRISPR product manual