CTBP2 (NM_001290214) Human Untagged Clone

CAT#: SC336164

CTBP2 (untagged) - Human C-terminal binding protein 2 (CTBP2), transcript variant 4



  "NM_001290214" in other vectors (2)

CNY 4,280.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CTBP2 mouse monoclonal antibody, clone OTI4D4 (formerly 4D4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC336164 representing NM_001290214.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCTTGTGGATAAGCACAAAGTCAAGAGACAGCGATTGGACAGAATTTGTGAAGGTATCCGCCCC
CAGATCATGAACGGCCCCCTGCACCCCCGCCCCCTGGTGGCGCTGCTGGACGGCCGCGACTGCACTGTG
GAGATGCCCATCCTGAAGGACCTGGCCACTGTGGCCTTCTGTGACGCGCAGTCGACGCAGGAAATCCAC
GAGAAGGTTCTAAACGAAGCCGTGGGCGCCATGATGTACCACACCATCACCCTCACCAGGGAGGACCTG
GAGAAGTTCAAGGCCCTGAGAGTGATCGTGCGGATAGGCAGTGGCTATGACAACGTGGACATCAAGGCT
GCCGGCGAGCTCGGAATTGCCGTGTGCAACATCCCGTCTGCAGCCGTGGAAGAGACAGCGGACTCTACC
ATCTGCCACATCCTCAACCTGTACCGGAGGAACACGTGGCTGTACCAGGCACTGCGGGAAGGCACGCGG
GTTCAGAGCGTGGAGCAGATCCGCGAGGTGGCCTCGGGAGCGGCCCGCATCCGTGGGGAGACGCTGGGC
CTCATTGGCTTTGGTCGCACGGGGCAGGCGGTTGCAGTTCGAGCCAAGGCCTTTGGATTCAGCGTCATA
TTTTATGACCCCTACTTGCAGGATGGGATCGAGCGGTCCCTGGGCGTGCAGAGGGTCTACACCCTGCAG
GATTTGCTGTATCAGAGCGACTGCGTCTCCTTGCACTGCAATCTCAACGAACATAACCACCACCTCATC
AATGACTTTACCATAAAGCAGATGAGGCAGGGAGCATTCCTTGTGAACGCAGCCCGTGGCGGCCTGGTG
GACGAGAAAGCCTTAGCACAAGCCCTCAAGGAGGGCAGGATACGAGGGGCAGCCCTCGACGTGCATGAG
TCAGAGCCCTTCAGCTTTGCTCAGGGTCCGTTGAAAGATGCCCCGAATCTCATCTGCACTCCTCACACT
GCCTGGTACAGTGAGCAGGCGTCACTGGAGATGAGGGAGGCAGCTGCCACCGAGATCCGCCGAGCCATC
ACAGGTCGCATCCCAGAAAGCTTAAGAAATTGTGTGAACAAGGAATTCTTTGTCACATCAGCGCCTTGG
TCAGTAATAGACCAGCAAGCAATTCATCCTGAGCTCAATGGTGCCACATACAGATATCCGCCAGGCATC
GTGGGTGTGGCTCCAGGAGGACTTCCTGCAGCCATGGAAGGGATCATCCCTGGAGGCATCCCAGTGACT
CACAACCTCCCGACAGTGGCACATCCTTCCCAAGCGCCCTCTCCCAACCAGCCCACAAAACACGGGGAC
AATCGAGAGCACCCCAACGAGCAATAG

Restriction Sites SgfI-MluI     
ACCN NM_001290214
Insert Size 1338 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290214.1
RefSeq Size 3425 bp
RefSeq ORF 1338 bp
Locus ID 1488
UniProt ID P56545
Protein Families Stem cell - Pluripotency, Stem cell relevant signaling - Wnt Signaling pathway
Protein Pathways Chronic myeloid leukemia, Notch signaling pathway, Pathways in cancer, Wnt signaling pathway
MW 48.9 kDa
Gene Summary This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (4) contains a distinct 5' UTR and 5' CDS, compared to variant 2. Variants 1, 3, 4, and 5-8 all encode the same isoform (1), which has a distinct N-terminus that is 540 aa shorter than the N-terminus of isoform 2. The protein is thought to bind to the C-terminus of the adenovirus E1A proteins. Studies in mice suggest that this protein is involved in transcriptional repression. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...