RHD (NM_001282872) Human Untagged Clone

CAT#: SC336085

RHD (untagged) - Human Rh blood group, D antigen (RHD), transcript variant 8



  "NM_001282872" in other vectors (2)

CNY 4,090.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RHD Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD240D; DIIIc; RH; Rh4; RH30; RHCED; RhDCw; RHDel; RHDVA(TT); RhII; RhK562-II; RhPI; RHPII; RHXIII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC336085 representing NM_001282872.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTCTAAGTACCCGCGGTCTGTCCGGCGCTGCCTGCCCCTCTGGGCCCTAACACTGGAAGCAGCT
CTCATTCTCCTCTTCTATTTTTTTACCCACTATGACGCTTCCTTAGAGGATCAAAAGGGGCTCGTGGCA
TCCTATCAAGTTGGCCAAGATCTGACCGTGATGGCGGCCATTGGCTTGGGCTTCCTCACCTCGAGTTTC
CGGAGACACAGCTGGAGCAGTGTGGCCTTCAACCTCTTCATGCTGGCGCTTGGTGTGCAGTGGGCAATC
CTGCTGGACGGCTTCCTGAGCCAGTTCCCTTCTGGGAAGGTGGTCATCACACTGTTCAGTATTCGGCTG
GCCACCATGAGTGCTTTGTCGGTGCTGATCTCAGTGGATGCTGTCTTGGGGAAGGTCAACTTGGCGCAG
TTGGTGGTGATGGTGCTGGTGGAGGTGACAGCTTTAGGCAACCTGAGGATGGTCATCAGTAATATCTTC
AACACAGACTACCACATGAACATGATGCACATCTACGTGTTCGCAGCCTATTTTGGGCTGTCTGTGGCC
TGGTGCCTGCCAAAGCCTCTACCCGAGGGAACGGAGGATAAAGATCAGACAGCAACGATACCCAGTTTG
TCTGCCATGCTGGGCGCCCTCTTCTTGTGGATGTTCTGGCCAAGTTTCAACTCTGCTCTGCTGAGAAGT
CCAATCGAAAGGAAGAATGCCGTGTTCAACACCTACTATGCTGTAGCAGTCAGCGTGGTGACAGCCATC
TCAGGGTCATCCTTGGCTCACCCCCAAGGGAAGATCAGCAAGACTTATGTGCACAGTGCGGTGTTGGCA
GGAGGCGTGGCTGTGGGTACCTCGTGTCACCTGATCCCTTCTCCGTGGCTTGCCATGGTGCTGGGTCTT
GTGGCTGGGCTGATCTCCGTCGGGGGAGCCAAGTACCTGCCGGGGTGTTGTAACCGAGTGCTGGGGATT
CCCCACAGCTCCATCATGGGCTACAACTTCAGCTTGCTGGGTCTGCTTGGAGAGATCATCTACATTGTG
CTGCTGGTGCTTGATACCGTCGGAGCCGGCAATGGCATGTCACTCGGCTGGAACCTGGCTGTAAAAATG
GCTGAAGCAGGTGATGAGGAGCTGATGCGTTTGGACGTGTCTCAGAGAAATCATGGAGGCGCTGCGGTT
CCTACCGGTTCTTGGATGCCTTCTACAGAGACAACCATAGCCCCAAATTATAGGGATCACATATCAGTG
GGATTGGCTTCCAGGTCCTCCTCAGCATTGGGGAACTCAGCTTGGCCATCGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282872
Insert Size 1296 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282872.1
RefSeq Size 2933 bp
RefSeq ORF 1296 bp
Locus ID 6007
Protein Families Transmembrane
MW 46.3 kDa
Gene Summary The Rh blood group system is the second most clinically significant of the blood groups, second only to ABO. It is also the most polymorphic of the blood groups, with variations due to deletions, gene conversions, and missense mutations. The Rh blood group includes this gene, which encodes the RhD protein, and a second gene that encodes both the RhC and RhE antigens on a single polypeptide. The two genes, and a third unrelated gene, are found in a cluster on chromosome 1. The classification of Rh-positive and Rh-negative individuals is determined by the presence or absence of the highly immunogenic RhD protein on the surface of erythrocytes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (8) contains an alternate exon and lacks another alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (8) has a longer and distinct C-terminus compared to isoform 1. Isoform 8 represents the longest isoform of this gene. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...