EOMES (NM_001278183) Human Untagged Clone

CAT#: SC335942

EOMES (untagged) - Human eomesodermin (EOMES), transcript variant 3



  "NM_001278183" in other vectors (2)

CNY 5,856.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal anti-EOMES antibody
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TBR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335942 representing NM_001278183.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTCCTTTCTTGAGCTTCAACATAAACGGACTCAATCCCACTGCCCACTACAATGTGTTCGTAGAG
GTGGTGCTGGCGGACCCCAACCACTGGCGCTTCCAGGGGGGCAAATGGGTGACCTGTGGCAAAGCCGAC
AATAACATGCAGGGCAACAAAATGTATGTTCACCCAGAGTCTCCTAATACTGGTTCCCACTGGATGAGA
CAGGAGATTTCATTCGGGAAATTAAAACTCACCAATAACAAAGGCGCAAATAACAACAACACCCAGATG
ATAGTCTTACAATCCTTACACAAATACCAACCCCGACTGCATATTGTTGAAGTTACAGAGGATGGCGTG
GAGGACTTGAATGAGCCCTCAAAGACCCAGACTTTTACCTTCTCAGAAACGCAATTCATTGCAGTGACT
GCCTACCAAAACACCGATATTACTCAACTAAAGATTGATCATAACCCCTTTGCAAAAGGCTTCAGAGAC
AACTATGATTCCATGTACACCGCTTCAGAAAATGACAGGTTAACTCCATCTCCCACGGATTCTCCTAGA
TCCCATCAGATTGTCCCTGGAGGTCGGTACGGCGTTCAATCCTTCTTCCCGGAGCCCTTTGTCAACACT
TTACCTCAAGCCCGCTATTATAATGGCGAGAGAACCGTGCCACAGACCAACGGCCTCCTTTCACCCCAA
CAGAGCGAAGAGGTGGCCAACCCTCCCCAGCGGTGGCTTGTCACGCCTGTCCAGCAACCTGGGACCAAC
AAACTAGACATCAGTTCCTATGAATCTGAATATACTTCTAGCACATTGCTCCCATATGGCATTAAATCC
TTGCCCCTTCAGACATCCCATGCCCTGGGGTATTACCCAGACCCAACCTTTCCTGCAATGGCAGGGTGG
GGAGGTCGAGGTTCTTACCAGAGGAAGATGGCAGCTGGACTACCATGGACCTCCAGAACAAGCCCCACT
GTGTTCTCTGAAGATCAGCTCTCCAAGGAGAAAGTGAAAGAGGAAATTGGCTCTTCTTGGATAGAGACA
CCCCCTTCCATCAAATCTCTAGATTCCAATGATTCAGGAGTATACACCAGTGCTTGTAAGCGAAGGCGG
CTGTCTCCTAGCAACTCCAGTAATGAAAATTCACCCTCCATAAAGTGTGAGGACATTAATGCTGAAGAG
TATAGTAAAGACACCTCAAAAGGCATGGGAGGGTATTATGCTTTTTACACAACTCCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278183
Insert Size 1233 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278183.1
RefSeq Size 2658 bp
RefSeq ORF 1233 bp
Locus ID 8320
UniProt ID O95936
Protein Families Embryonic stem cells, ES Cell Differentiation/IPS, Transcription Factors
MW 46 kDa
Gene Summary This gene belongs to the TBR1 (T-box brain protein 1) sub-family of T-box genes that share the common DNA-binding T-box domain. The encoded protein is a transcription factor which is crucial for embryonic development of mesoderm and the central nervous system in vertebrates. The protein may also be necessary for the differentiation of effector CD8+ T cells which are involved in defense against viral infections. A similar gene disrupted in mice is shown to be essential during trophoblast development and gastrulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (3) differs in the 5' UTR, 5' coding region and initiates translation at a downstream AUG, compared to variant 1. It encodes isoform 3 which has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...