SLC2A2 (NM_001278658) Human Untagged Clone

CAT#: SC335912

SLC2A2 (untagged) - Human solute carrier family 2 (facilitated glucose transporter), member 2 (SLC2A2), transcript variant 2



  "NM_001278658" in other vectors (2)

CNY 3,900.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Glut2 Antibody
    • 100 ul

CNY 5,560.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GLUT2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335912 representing NM_001278658.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACCTCAACAGAATCAAAGCCATGTTAGTAGCAAACATTCTGTCATTAGTTGGAGCTCTCTTGATG
GGGTTTTCAAAATTGGGACCATCTCATATACTTATAATTGCTGGAAGAAGCATATCAGGACTATATTGT
GGGCTAATTTCAGGCCTGGTTCCTATGTATATCGGTGAAATTGCTCCAACCGCTCTCAGGGGAGCACTT
GGCACTTTTCATCAGCTGGCCATCGTCACGGGCATTCTTATTAGTCAGATTATTGGTCTTGAATTTATC
TTGGGCAATTATGATCTGTGGCACATCCTGCTTGGCCTGTCTGGTGTGCGAGCCATCCTTCAGTCTCTG
CTACTCTTTTTCTGTCCAGAAAGCCCCAGATACCTTTACATCAAGTTAGATGAGGAAGTCAAAGCAAAA
CAAAGCTTGAAAAGACTCAGAGGATATGATGATGTCACCAAAGATATTAATGAAATGAGAAAAGAAAGA
GAAGAAGCATCGAGTGAGCAGAAAGTCTCTATAATTCAGCTCTTCACCAATTCCAGCTACCGACAGCCT
ATTCTAGTGGCACTGATGCTGCATGTGGCTCAGCAATTTTCCGGAATCAATGGCATTTTTTACTACTCA
ACCAGCATTTTTCAGACGGCTGGTATCAGCAAACCTGTTTATGCAACCATTGGAGTTGGCGCTGTAAAC
ATGGTTTTCACTGCTGTCTCTGTATTCCTTGTGGAGAAGGCAGGGCGACGTTCTCTCTTTCTAATTGGA
ATGAGTGGGATGTTTGTTTGTGCCATCTTCATGTCAGTGGGACTTGTGCTGCTGAATAAGTTCTCTTGG
ATGAGTTATGTGAGCATGATAGCCATCTTCCTCTTTGTCAGCTTCTTTGAAATTGGGCCAGGCCCGATC
CCCTGGTTCATGGTGGCTGAGTTTTTCAGTCAAGGACCACGTCCTGCTGCTTTAGCAATAGCTGCATTC
AGCAATTGGACCTGCAATTTCATTGTAGCTCTGTGTTTCCAGTACATTGCGGACTTCTGTGGACCTTAT
GTGTTTTTCCTCTTTGCTGGAGTGCTCCTGGCCTTTACCCTGTTCACATTTTTTAAAGTTCCAGAAACC
AAAGGAAAGTCTTTTGAGGAAATTGCTGCAGAATTCCAAAAGAAGAGTGGCTCAGCCCACAGGCCAAAA
GCTGCTGTAGAAATGAAATTCCTAGGAGCTACAGAGACTGTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278658
Insert Size 1218 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278658.1
RefSeq Size 3176 bp
RefSeq ORF 1218 bp
Locus ID 6514
UniProt ID P11168
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Maturity onset diabetes of the young, Type II diabetes mellitus
MW 44.7 kDa
Gene Summary This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks an alternate exon in the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments and experimental data in the literature (PMID: 11978637).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...