CTNNA3 (NM_001291133) Human Untagged Clone

CAT#: SC335805

CTNNA3 (untagged) - Human catenin (cadherin-associated protein), alpha 3 (CTNNA3), transcript variant 3



  "NM_001291133" in other vectors (2)

CNY 3,710.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CTNNA3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARVD13; VR22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335805 representing NM_001291133.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAATCAACGCAAAGGAGAGAGAAACAAGGCAGCATGTCAGCTGAAACACCAATCACATTGAATATC
GATCCTCAGGATCTGCAGGTCCAAACATTCACCGTGGAGAAGCTACTGGAGCCTCTCATAATCCAGGTT
ACCACACTTGTAAACTGTCCCCAGAACCCTTCCAGCAGGAAAAAAGGACGTTCGAAAAGAGCCAGTGTC
CTTCTAGCTTCTGTGGAGGAAGCAACTTGGAATTTATTAGACAAGGGAGAGAAGATTGCCCAGGAAGCT
ACAGTTTTAAAGGATGAGCTTACGGCTTCACTTGAGGAAGTTCGCAAAGAAAGTGAAGCTCTGAAAGTA
TCAGCTGAGAGATTTACAGATGACCCCTGTTTTCTCCCAAAAAGGGAGGCTGTGGTTCAAGCTGCCCGT
GCCTTGCTGGCTGCGGTGACGAGACTCCTTATCCTTGCGGACATGATTGATGTCATGTGCCTCTTGCAA
CATGTGTCAGCTTTTCAAAGGACATTTGAGTCTCTCAAAAATGTTGCCAACAAATCTGACCTCCAGAAA
ACCTACCAGAAGCTTGGGAAGGAGCTGGAAAATTTGGATTATTTAGCCTTCAAACGTCAGCAGGACTTA
AAATCTCCAAATCAGAGAGATGAAATTGCAGGAGCCCGAGCTTCACTGAAGGAGAACTCTCCCCTCTTG
CATTCAATTTGTTCAGCTTGTTTGGAGCATTCTGATGTTGCTTCCCTCAAAGCAAGCAAGGACACAGTT
TGTGAAGAAATTCAGAATGCTCTCAATGTAATTTCAAATGCTTCACAAGGGATCCAGAATATGACAACC
CCACCAGAACCTCAGGCAGCAACCCTGGGAAGTGCCCTTGATGAGCTGGAGAATTTAATTGTCCTGAAT
CCACTCACAGTAACTGAGGAGGAAATACGACCATCACTAGAGAAACGCCTTGAAGCCATTATCAGTGGG
GCTGCTCTGCTGGCGGATTCTTCATGTACGAGGGACTTACACCGAGAGCGGATTATCGCAGAATGCAAC
GCCATTCGCCAGGCTCTTCAGGATCTGCTTTCAGAGTACATGAACAACCTCTGTAATCAAAAGTCTGAC
CTGGGCCTCACTGGAGTAAAAATCAAATTGTTGGAGGAATGCATTATTTTCTGGAGTCTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291133
Insert Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291133.1
RefSeq Size 2790 bp
RefSeq ORF 1167 bp
Locus ID 29119
Protein Pathways Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Endometrial cancer, Leukocyte transendothelial migration, Pathways in cancer, Tight junction
MW 43 kDa
Gene Summary This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (3) has multiple differences compared to variant 1. These differences result in distinct 5' and 3' UTRs and cause translation initiation at an alternate start codon compared to variant 1. The encoded protein (isoform b) has a longer N-terminus, a distinct C-terminus, and is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. The intron between the last two exons of the source sequence is in a repeat-rich region and appears to be an artifact. This intron was replaced by genomic sequence to merge the two exons into one long exon.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...