DFFB (NM_001282669) Human Untagged Clone

CAT#: SC335625

DFFB (untagged) - Human DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) (DFFB), transcript variant 1



  "NM_001282669" in other vectors (2)

CNY 3,520.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-DFFB Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAD; CPAN; DFF-40; DFF2; DFF40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335625 representing NM_001282669.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCCAGAAGCCCAAGAGCGTGAAGCTGCGGGCCCTGCGCAGCCCGAGGAAGTTCGGCGTGGCTGGC
CGGAGCTGCCAGGAGGTGCTGCGCAAGGGCTGTCTCCGCTTCCAGCTCCCTGAGCGCGGTTCCCGGCTG
TGCCTGTACGAGGATGGCACGGAGCTGACGGAAGATTACTTCCCCAGTGTTCCCGACAACGCCGAGCTG
GTGCTGCTCACCTTGGGCCAGGCCTGGCAGGGCTGTGAGTGGCAAGGACTTTGGAGGATGTGTCTTCTG
CTGGACCGGCACCTTTTGTTTGTCCCATTGGTGGCAGATGTGAGCGACATCAGGCGCTTCCTCAGTGCA
TTTCACGAGCCACAGGTGGGGCTCATCCAGGCCGCCCAGCAGCTGCTGTGTGATGAGCAGGCCCCACAG
AGGCAGAGGCTGCTGGCTGACCTCCTGCACAACGTCAGCCAGAACATCGCGGCCGAGACCCGGGCTGAG
GACCCGCCGTGGTTTGAAGGCTTGGAGTCCCGATTTCAGAGCAAGTCTGGCTATCTGAGATACAGCTGT
GAGAGCCGGATCCGGAGTTACCTGAGGGAGGTGAGCTCCTACCCCTCCACGGTGGGTGCGGAGGCTCAG
GAGGAATTCCTGCGGGTCCTCGGCTCCATGTGCCAGAGGCTCCGGTCCATGCAGTACAATGGCAGCTAC
TTCGACAGAGGAGCCAAGGGCGGCAGCCGCCTCTGCACACCGGAAGGCTGGTTCTCCTGCCAGGGTCCC
TTTGACATGGACAGCTGCTTATCAAGACACTCCATCAACCCCTACAGTAACAGGGAGAGCAGGATCCTC
TTCAGCACCTGGAACCTGGATCACATAATAGAAAAGAAACGCACCATCATTCCTACACTGGTGGAAGCA
ATTAAGGAACAAGATGGAAGAGAAGTGGACTGGGAGTATTTTTATGGCCTGCTTTTTACCTCAGAGAAC
CTAAAACTAGTGCACATTGTCTGCCATAAGAAAACCACCCACAAGCTCAACTGTGACCCAAGCAGAATC
TACAAACCCCAGACAAGGTTGAAGCGGAAGCAGCCTGTGCGGAAACGCCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282669
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282669.2
RefSeq Size 2905 bp
RefSeq ORF 1089 bp
Locus ID 1677
Protein Families Druggable Genome
Protein Pathways Apoptosis
MW 42 kDa
Gene Summary Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some of these variants has not been determined. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...