ADPRH (NM_001291949) Human Untagged Clone

CAT#: SC335582

ADPRH (untagged) - Human ADP-ribosylarginine hydrolase (ADPRH), transcript variant 2



  "NM_001291949" in other vectors (2)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ADPRH Antibody - C-terminal region
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARH1; hARH1
Vector pCMV6-Entry
Sequence Data
>SC335582 representing NM_001291949.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGAAGTATGTGGCTGCTATGGTGCTGAGTGCAGCTGGAGATGCCCTGGGGTACTACAATGGGAAG
TGGGAGTTCCTCCAGGATGGGGAGAAGATACACCGGCAGTTGGCCCAGCTGGGCGGCTTGGATGCCCTA
GACGTGGGAAGGTGGAGAGTTAGTGACGACACAGTGATGCACTTGGCCACAGCAGAAGCTCTTGTGGAA
GCTGGGAAAGCCCCTAAGTTGACTCAACTGTATTACCTCCTTGCTAAGCATTACCAAGACTGCATGGAA
GACATGGATGGGCGGGCACCAGGTGGTGCCTCGGTGCACAACGCCATGCAGCTGAAGCCGGGCAAGCCC
AATGGCTGGAGGATTCCCTTCAACAGCCATGAGGGCGGCTGTGGGGCTGCCATGCGGGCCATGTGCATC
GGTCTCAGGTTCCCACACCATAGCCAACTGGACACACTGATCCAAGTGAGCATCGAGAGTGGTCGGATG
ACCCACCACCACCCAACAGGCTACCTGGGGGCCCTTGCGTCTGCTCTTTTTACAGCCTATGCTGTGAAT
AGCAGACCACCCTTGCAGTGGGGAAAAGGACTGATGGAGCTGCTACCAGAAGCTAAAAAGTACATTGTC
CAATCAGGCTACTTTGTAGAGGAAAATCTTCAACACTGGTCCTACTTCCAAACCAAATGGGAAAATTAC
CTAAAACTTAGAGGGATTTTGGATGGAGAATCAGCCCCTACCTTCCCTGAGTCTTTCGGTGTGAAGGAG
AGGGATCAGTTCTACACCTCCCTGAGCTACTCTGGCTGGGGTGGCAGCAGTGGGCACGATGCCCCCATG
ATTGCCTACGATGCTGTTCTTGCTGCAGGAGACTCCTGGAAGGAGCTTGCCCACCGAGCCTTTTTCCAT
GGTGGAGACAGTGATTCTACAGCTGCCATTGCTGGCTGCTGGTGGGGAGTTATGTATGGTTTTAAAGGA
GTGAGTCCCTCCAACTATGAGAAACTAGAATACAGAAACCGGCTGGAAGAGACAGCTAGGGCTTTATAT
TCTCTCGGGTCAAAAGAAGACACTGTAATTTCCCTTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001291949
Insert Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291949.1
RefSeq Size 3618 bp
RefSeq ORF 1074 bp
Locus ID 141
UniProt ID P54922
MW 39.5 kDa
Gene Summary The enzyme encoded by this gene catalyzes removal of mono-ADP-ribose from arginine residues of proteins in the ADP-ribosylation cycle. Unlike the rat and mouse enzymes that require DTT for maximal activity, the human enzyme is DTT-independent. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, May 2014]
Transcript Variant: This variant (2) lacks an exon in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...