Cytohesin 1 (CYTH1) (NM_001292018) Human Untagged Clone

CAT#: SC335457

CYTH1 (untagged) - Human cytohesin 1 (CYTH1), transcript variant 3



  "NM_001292018" in other vectors (2)

CNY 3,330.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CYTH1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B2-1; CYTOHESIN-1; D17S811E; PSCD1; SEC7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335457 representing NM_001292018.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGAGGAACAAACAGGTAGCCATGGGCAGGAAAAAATTTAATATGGACCCTAAAAAGGGGATCCAG
TTCTTAATAGAGAACGACCTCCTGAAGAACACTTGTGAAGACATTGCCCAGTTCTTATATAAAGGCGAA
GGGCTCAACAAGACAGCCATCGGCGACTACCTAGGGGAGAGAGATGAGTTTAATATCCAGGTTCTTCAT
GCATTTGTGGAGCTGCATGAGTTCACTGATCTTAATCTCGTCCAGGCACTACGGCAGTTCCTGTGGAGC
TTCCGGCTACCCGGAGAGGCCCAGAAGATCGACCGGATGATGGAGGCGTTTGCCCAGCGATATTGTCAG
TGCAATAATGGCGTGTTCCAGTCCACGGATACTTGTTACGTCCTCTCCTTTGCCATCATCATGTTGAAC
ACCAGTCTGCACAACCCCAATGTCAAAGATAAGCCCACTGTGGAGAGGTTCATTGCCATGAACCGAGGC
ATCAATGATGGGGGAGACCTGCCGGAGGAGCTCCTCCGGAATCTCTATGAGAGCATAAAAAATGAACCC
TTTAAAATCCCAGAAGACGACGGGAATGACCTCACTCACACTTTCTTCAATCCAGACCGAGAAGGCTGG
CTATTGAAACTCGGAGGTGGCAGGGTAAAGACTTGGAAGAGACGCTGGTTCATTCTGACTGACAACTGC
CTTTACTACTTTGAGTATACCACGGATAAGGAGCCCCGTGGAATCATCCCTTTAGAGAATCTGAGTATC
CGGGAAGTGGAGGACTCCAAAAAACCAAACTGCTTTGAGCTTTATATCCCCGACAATAAAGACCAAGTT
ATCAAGGCCTGCAAGACCGAGGCTGACGGGCGGGTGGTGGAGGGGAACCACACTGTTTACCGGATCTCA
GCTCCGACGCCCGAGGAGAAGGAGGAGTGGATTAAGTGCATTAAAGCAGCCATCAGCAGGGACCCTTTC
TACGAAATGCTCGCAGCACGGAAAAAGAAGGTCTCCTCCACGAAGCGACACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001292018
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001292018.1
RefSeq Size 3763 bp
RefSeq ORF 1020 bp
Locus ID 9267
UniProt ID Q15438
MW 39.5 kDa
Gene Summary The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (3) uses an alternate 5'-terminal exon, differs in its 5' UTR, and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Both variants 3 and 4 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...