GRAP2 (NM_001291824) Human Untagged Clone

CAT#: SC335382

GRAP2 (untagged) - Human GRB2-related adaptor protein 2 (GRAP2), transcript variant 1



  "NM_001291824" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
GRAP2 mouse monoclonal antibody, clone OTI1G2 (formerly 1G2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GADS; GRAP-2; GRB2L; GRBLG; GrbX; Grf40; GRID; GRPL; Mona; P38
Vector pCMV6-Entry
Sequence Data
>SC335382 representing NM_001291824.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAGCTGTTGCCAAGTTTGATTTCACTGCTTCAGGTGAGGATGAACTGAGCTTTCACACTGGAGAT
GTTTTGAAGATTTTAAGTAACCAAGAGGAGTGGTTTAAGGCGGAGCTTGGGAGCCAGGAAGGATATGTG
CCCAAGAATTTCATAGACATCCAGTTTCCCAAATGGTTTCACGAAGGCCTCTCTCGACACCAGGCAGAG
AACTTACTCATGGGCAAGGAGGTTGGCTTCTTCATCATCCGGGCCAGCCAGAGCTCCCCAGGGGACTTC
TCCATCTCTGTCAGGCATGAGGATGACGTTCAACACTTCAAGGTCATGCGAGACAACAAGGGTAATTAC
TTTCTGTGGACTGAGAAGTTTCCATCCCTAAATAAGCTGGTAGACTACTACAGGACAAATTCCATCTCC
AGACAGAAGCAGATCTTCCTTAGAGACAGAACCCGAGAAGACCAGGGTCACCGGGGCAACAGCCTGGAC
CGGAGGTCCCAGGGAGGCCCACACCTCAGTGGGGCTGTGGGAGAAGAAATCCGACCTTCGATGAACCGG
AAGCTGTCGGATCACCCCCCGACCCTTCCCCTGCAGCAGCACCAGCACCAGCCACAGCCTCCGCAATAT
GCCCCAGCGCCCCAGCAGCTGCAGCAGCCCCCACAGCAGCGATATCTGCAGCACCACCATTTCCACCAG
GAACGCCGAGGAGGCAGCCTTGACATAAATGATGGGCATTGTGGCACCGGCTTGGGCAGTGAAATGAAT
GCGGCCCTCATGCATCGGAGACACACAGACCCAGTGCAGCTCCAGGCGGCAGGGCGAGTGCGGTGGGCC
CGGGCGCTGTATGACTTTGAGGCCCTGGAGGATGACGAGCTGGGGTTCCACAGCGGGGAGGTGGTGGAG
GTCCTGGATAGCTCCAACCCATCCTGGTGGACCGGCCGCCTGCACAACAAGCTGGGCCTCTTCCCTGCC
AACTACGTGGCACCCATGACCCGATAA

Restriction Sites SgfI-MluI     
ACCN NM_001291824
Insert Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291824.1
RefSeq Size 3528 bp
RefSeq ORF 993 bp
Locus ID 9402
UniProt ID O75791
Protein Families Druggable Genome
Protein Pathways T cell receptor signaling pathway
MW 37.9 kDa
Gene Summary This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (1) encodes the longest isoform (1). Variants 1, 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...