TTC8 (NM_001288782) Human Untagged Clone

CAT#: SC335307

TTC8 (untagged) - Human tetratricopeptide repeat domain 8 (TTC8), transcript variant 5



  "NM_001288782" in other vectors (2)

CNY 3,140.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Anti-TTC8 Antibody
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BBS8; RP51
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335307 representing NM_001288782.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATTTTGAGTTATGAAGTAATATTACACGCTTTGGATCTGGCTGCCCTCTCCACAGAACATTCTCAG
TACAAGGACTGGTGGTGGAAAGTACAGATTGGAAAATGTTACTACAGGTTGGGAATGTATCGTGAAGCA
GAAAAACAGTTTAAATCAGCCCTGAAGCAGCAGGAAATGGTAGATACATTTCTGTACTTGGCAAAAGTT
TATGTCTCATTGGATCAACCTGTGACTGCTTTAAATCTTTTCAAACAAGGCTTAGATAAGTTTCCAGGA
GAAGTAACCCTGCTCTGTGGAATTGCAAGAATCTATGAGGAAATGAACAATATGTCATCAGCAGCAGAA
TATTACAAAGAAGTTTTGAAACAAGACAATACTCATGTGGAAGCCATCGCATGCATTGGAAGCAACCAC
TTCTATTCTGATCAGCCAGAAATAGCTCTCCGGTTTTACAGGCGGCTGCTGCAGATGGGCATTTATAAC
GGCCAGCTTTTTAACAATCTGGGGCTGTGTTGCTTCTATGCCCAGCAGTATGATATGACTCTGACCTCA
TTTGAACGTGCCCTTTCTTTGGCTGAAAATGAAGAAGAGGCAGCTGATGTCTGGTACAACTTGGGACAT
GTAGCTGTGGGAATAGGAGATACAAATTTGGCCCATCAGTGCTTCAGGCTGGCTCTGGTCAACAACAAC
AACCACGCCGAGGCCTACAACAACCTGGCTGTGCTGGAGATGCGGAAGGGCCACGTTGAACAGGCAAGG
GCACTATTACAAACTGCATCATCATTAGCACCCCATATGTATGAACCGCATTTTAATTTTGCAACAATC
TCTGATAAGATTGGAGATCTGCAGAGAAGCTATGTTGCTGCGCAGAAGTCTGAAGCAGCATTTCCAGAC
CATGTGGACACACAACATTTAATTAAACAATTAAGGCAGCATTTTGCTATGCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001288782
Insert Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288782.1
RefSeq Size 2315 bp
RefSeq ORF 954 bp
Locus ID 123016
UniProt ID Q8TAM2
MW 36.4 kDa
Gene Summary This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is involved in the formation of cilia. A mutation in this gene has also been implicated in nonsyndromic retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (5) differs in its 5' UTR, uses an alternate start codon and an alternate splice site in its 5' coding region, and lacks an exon in its 5' coding region, compared to variant 1. The encoded isoform (E) has a shorter and distinct N-terminus, compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...