WIPI2 (NM_001278299) Human Untagged Clone

CAT#: SC335256

WIPI2 (untagged) - Human WD repeat domain, phosphoinositide interacting 2 (WIPI2), transcript variant 6



  "NM_001278299" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


WIPI2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATG18B; Atg21; CGI-50; IDDSSA; WIPI-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335256 representing NM_001278299.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGTGCTGCATACGATCAGGGAGACGCCTCCAAACCCTGCAGGCCTGTGTGCGCTGTCAATCAAC
AACGACAACTGCTACTTGGCGTACCCAGGGAGCGCGACCATCGGAGAGGTGCAGGTCTTCGATACCATT
AATTTGAGAGCTGCAAACATGATTCCGGCTCACGACAGTCCTTTAGCGGCACTGGCCTTTGACGCAAGT
GGAACTAAACTTGCCACGGCTTCGGAGAAGGGGACCGTGATTAGGGTATTTTCCATTCCAGAAGGACAA
AAACTCTTTGAGTTTCGGAGAGGAGTAAAGAGGTGCGTGAGCATCTGCTCCCTGGCCTTCAGCATGGAC
GGCATGTTCCTCTCCGCCTCCAGCAACACTGAGACCGTGCACATCTTCAAACTCGAGACTGTGAAAGAA
AAACCCCCAGAGGAGCCCACCACCTGGACCGGGTACTTCGGGAAAGTGCTCATGGCCTCCACCAGCTAC
CTGCCTTCCCAAGTGACAGAAATGTTCAACCAGGGCAGAGCCTTCGCCACGGTCCGCCTGCCATTCTGC
GGCCACAAAAACATCTGCTCGCTAGCCACAATTCAGAAGATCCCGCGGTTGTTGGTGGGTGCCGCCGAC
GGGTACCTGTACATGTACAACCTGGACCCCCAGGAGGGCGGCGAGTGTGCCCTGATGAAGCAGCACCGG
CTGGACGGCAGTCTGGAAACGACCAATGAGATCTTGGACTCTGCCTCTCACGACTGCCCCTTAGTCACT
CAGACATACGGCGCAGCTGCAGGAAAAGGTACTTACGTGCCTTCATCCCCAACGAGACTTGCCTACACA
GACGACCTGGGTGCTGTGGGTGGCGCCTGCCTGGAGGACGAGGCCAGCGCCCTGCGCCTGGATGAGGAC
AGCGAGCACCCGCCCATGATTCTTCGGACTGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278299
Insert Size 933 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278299.1
RefSeq Size 4663 bp
RefSeq ORF 933 bp
Locus ID 26100
UniProt ID Q9Y4P8
MW 33.5 kDa
Gene Summary WD40 repeat proteins are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins, such as WIPI2, have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids (Proikas-Cezanne et al., 2004 [PubMed 15602573]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (6) uses an alternate splice junction in a 5' exon compared to variant 1. This difference causes translation initiation at a downstream AUG and results in an isoform (f) with a shorter N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...