CACNA2D1 (NM_001302890) Human Untagged Clone

CAT#: SC335255

CACNA2D1 (untagged) - Human calcium channel, voltage-dependent, alpha 2/delta subunit 1 (CACNA2D1), transcript variant 2



  "NM_001302890" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CACNA2D1 Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CACNA2; CACNL2A; CCHL2A; LINC01112; lncRNA-N3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335255 representing NM_001302890.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCTGGCTGCCTGCTGGCCTTGACTCTGACACTTTTCCAATCTTTGCTCATCGGCCCCTCGTCG
GAGGAGCCGTTCCCTTCGGCCGTCACTATCAAATCATGGGTGGATAAGATGCAAGAAGACCTTGTCACA
CTGGCAAAAACAGCAAGTGGAGTCAATCAGCTTGTTGATATTTATGAGAAATATCAAGATTTGTATACT
GTGGAACCAAATAATGCACGCCAGCTGGTAGAAATTGCAGCCAGGGATATTGAGAAACTTCTGAGCAAC
AGATCTAAAGCCCTGGTGCGCCTGGCATTGGAAGCGGAGAAAGTTCAAGCAGCTCACCAGTGGAGAGAA
GATTTTGCAAGCAATGAAGTTGTCTACTACAATGCAAAGGATGATCTCGATCCTGAGAAAAATGACAGT
GAGCCAGGCAGCCAGAGGATAAAACCTGTTTTCATTGAAGATGCTAATTTTGGACGACAAATATCTTAT
CAGCACGCAGCAGTCCATATTCCTACTGACATCTATGAGGGCTCAACAATTGTGTTAAATGAACTCAAC
TGGACAAGTGCCTTAGATGAAGTTTTCAAAAAGAATCGCGAGGAAGACCCTTCATTATTGTGGCAGGTT
TTTGGCAGTGCCACTGGCCTAGCTCGATATTATCCAGCTTCACCATGGGTTGATAATAGTAGAACTCCA
AATAAGATTGACCTTTATGATGTACGCAGAAGACCATGGTACATCCAAGGAGCTGCATCTCCTAAAGAC
ATGCTTATTCTGGTGGATGTGAGTGGAAGTGTTAGTGGATTGACACTTAAACTGATCCGAACATCTGTC
TCCGAAATGTTAGAAACCCTCTCAGATGATGATTTCGTGAATGTAGCTTCAGATAGTAAAGAGATTTCT
CCTTCTCCCGAAGAGATTTTCAATGCAGAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001302890
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302890.1
RefSeq Size 1538 bp
RefSeq ORF 930 bp
Locus ID 781
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
MW 34.6 kDa
Gene Summary The preproprotein encoded by this gene is cleaved into multiple chains that comprise the alpha-2 and delta subunits of the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. Mutations in this gene can cause cardiac deficiencies, including Brugada syndrome and short QT syndrome. Alternate splicing results in multiple transcript variants, some of which may lack the delta subunit portion. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (2) lacks multiple 3' exons and contains an alternate 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. This isoform lacks the entire delta chain and a large portion of the alpha-2 chain.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...