ZDHHC16 (NM_001287804) Human Untagged Clone

CAT#: SC335241

ZDHHC16 (untagged) - Human zinc finger, DHHC-type containing 16 (ZDHHC16), transcript variant 7



  "NM_001287804" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal anti-ZDHHC18 antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APH2; DHHC-16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335241 representing NM_001287804.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGAGGCCAGCGGAGCCTGCTGCTGGGCCCGGCCCGCCTCTGCCTCCGCCTCCTTCTGCTGCTGGGT
TACAGGCGCCGCTGTCCACCTCTACTCCGGGGTCTAGTACAGCGCTGGCGCTACGGCAAGGTCTGCCTG
CGCTCCCTGCTCTACAACTCCTTTGGGGGCAGTGACACCGCTGTTGATGCTGCCTTTGAGCCTGTCTAC
TGGCTGGTAGACAACGTGATCCGCTGGTTTGGAGTGGTGTTCGTGGTCCTGGTGATCGTGCTGACAGGC
TCCATTGTAGCTATCGCCTACCTGTGTGTCCTGCCTCTCATCCTCCGAACCTACTCAGTGCCACGACTC
TGCTGGCATTTCTTCTATAGCCACTGGAATCTGATCCTGATTGTCTTCCACTACTACCAGGCCATCACC
ACTCCGCCTGGGTACCCACCCCAGGGCAGGAATGATATCGCCACCGTCTCCATCTGTAAGAAGTGCATT
TACCCCAAGCCAGCCCGAACACACCACTGCAGCATCTGCAACAGGTGTGTGCTGAAGATGGATCACCAC
TGCCACATACTTCCTCCAGCCCTCTCTAAACTACCCACCAGTCTTCGCCCCTCTTTTCTTAGTTCTGTG
GCACTTGCCCTGGGTGCCCTAACTGTATGGCATGCTGTTCTCATCAGTCGAGGTGAGACTAGCATCGAA
AGGCACATCAACAAGAAGGAGAGACGTCGGCTACAGGCCAAGGGCAGAGTATTTAGGAATCCTTACAAC
TACGGCTGCTTGGACAACTGGAAGGTATTCCTGGGTGTGGATACAGGAAGGCACTGGCTTACTCGGGTG
CTCTTACCTTCTAGTCACTTGCCCCATGGGAATGGAATGAGCTGGGAGCCCCCTCCCTGGGTGACTGCT
CACTCAGCCTCTGTGATGGCAGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001287804
Insert Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287804.1
RefSeq Size 1646 bp
RefSeq ORF 924 bp
Locus ID 84287
UniProt ID Q969W1
Protein Families Transmembrane
MW 35 kDa
Gene Summary Palmitoyl acyltransferase that mediates palmitoylation of proteins such as PLN and ZDHHC6 (PubMed:28826475). Required during embryonic heart development and cardiac function, possibly by mediating palmitoylation of PLN, thereby affecting PLN phosphorylation and homooligomerization (By similarity). Also required for eye development (By similarity). Palmitoylates ZDHHC6, affecting the quaternary assembly of ZDHHC6, its localization, stability and function (PubMed:28826475). May play a role in DNA damage response (By similarity). May be involved in apoptosis regulation (By similarity). Involved in the proliferation of neural stem cells by regulating the FGF/ERK pathway (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) lacks three exons in the central and 3' coding regions and uses an alternate in-frame splice site in the 3' coding region, compared to variant 5. It encodes isoform 6, which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...