Chromogranin A (CHGA) (NM_001301690) Human Untagged Clone

CAT#: SC335236

CHGA (untagged) - Human chromogranin A (parathyroid secretory protein 1) (CHGA), transcript variant 2



  "NM_001301690" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CHGA mouse monoclonal antibody,clone OTI2E12
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335236 representing NM_001301690.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCTCCGCCGCTGTCCTGGCTCTTCTGCTCTGCGCCGGGCAAGTCACTGCGCTCCCTGTGAACAGC
CCTATGAATAAAGGGGATACCGAGGTGATGAAATGCATCGTTGAGGTCATCTCCGACACACTTTCCAAG
CCCAGCCCCATGCCTGTCAGCCAGGAATGTTTTGAGACACTCCGAGGAGATGAACGGATCCTTTCCATT
CTGAGACATCAGAATTTACTGAAGGAGCTCCAAGACCTCGCTCTCCAAGGCGCCAAGGAGAGGGCACAT
CAGCAGAAGAAACACAGCGGTTTTGAAGATGAACTCTCAGAGGTTCTTGAGAACCAGAGCAGCCAGGCC
GAGCTGAAAGGTCGGTCGGAGGCTCTGGCTGTGGATGGAGCTGGGAAGCCTGGGGCTGAGGAGGCTCAG
GACCCCGAAGGGAAGGGAGAACAGGAGCACTCCCAGCAGAAAGAGGAGGAGGAGGAGATGGCAGTGGTC
CCGCAAGGCCTCTTCCGGGGTGGGAAGAGCGGAGAGCTGGAGCAGGAGGAGGAGCGGCTCTCCAAGGAG
TGGGAGGACTCCAAACGCTGGAGCAAGATGGACCAGCTGGCCAAGGAGCTGACGGCTGAGAAGCGGCTG
GAGGGGCAGGAGGAGGAGGAGGACAACCGGGACAGTTCCATGAAGCTCTCCTTCCGGGCCCGGGCCTAC
GGCTTCAGGGGCCCTGGGCCGCAGCTGCGACGAGGCTGGAGGCCATCCTCCCGGGAGGACAGCCTTGAG
GCGGGCCTGCCCCTCCAGGTCCGAGGCTACCCCGAGGAGAAGAAAGAGGAGGAGGGCAGCGCAAACCGC
AGACCAGAGGACCAGGAGCTGGAGAGCCTGTCGGCCATTGAAGCAGAGCTGGAGAAAGTGGCCCACCAG
CTGCAGGCACTACGGCGGGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301690
Insert Size 921 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301690.1
RefSeq Size 1626 bp
RefSeq ORF 921 bp
Locus ID 1113
UniProt ID P10645
Protein Families Druggable Genome, Secreted Protein
MW 34.3 kDa
Gene Summary The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. It is found in secretory vesicles of neurons and endocrine cells. This gene product is a precursor to three biologically active peptides; vasostatin, pancreastatin, and parastatin. These peptides act as autocrine or paracrine negative modulators of the neuroendocrine system. Two other peptides, catestatin and chromofungin, have antimicrobial activity and antifungal activity, respectively. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...