SLC35B2 (NM_001286520) Human Untagged Clone

CAT#: SC335194

SLC35B2 (untagged) - Human solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2 (SLC35B2), transcript variant 9



  "NM_001286520" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SLC35B2 Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PAPST1; SLL; UGTrel4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335194 representing NM_001286520.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCGCAGCTATGGGGCCACAGCCACATCACCGGGTGAGCGCTTTACGGACTCGCAGTTCCTGGTG
CTAATGAACCGAGTGCTGGCACTGATTGTGGCTGGCCTCTCCTGTGTTCTCTGCAAGCAGCCCCGGCAT
GGGGCACCCATGTACCGGTACTCCTTTGCCAGCCTGTCCAATGTGCTTAGCAGCTGGTGCCAATACGAA
GCTCTTAAGTTCGTCAGCTTCCCCACCCAGGTGCTGGCCAAGGCCTCTAAGGTGATCCCTGTCATGCTG
ATGGGAAAGCTTGTGTCTCGGCGCAGCTACGAACACTGGGAGTACCTGACAGCCACCCTCATCTCCATT
GGGGTCAGCATGTTTCTGCTATCCAGCGGACCAGAGCCCCGCAGCTCCCCAGCCACCACACTCTCAGGC
CTCATCTTACTGGCAGGTTATATTGCTTTTGACAGCTTCACCTCAAACTGGCAGGATGCCCTGTTTGCC
TATAAGATGTCATCGGTGCAGATGATGTTTGGGGTCAATTTCTTCTCCTGCCTCTTCACAGTGGGCTCA
CTGCTAGAACAGGGGGCCCTACTGGAGGGAACCCGCTTCATGGGGCGACACAGTGAGTTTGCTGCCCAT
GCCCTGCTACTCTCCATCTGCTCCGCATGTGGCCAGCTCTTCATCTTTTACACCATTGGGCAGTTTGGG
GCTGCCGTCTTCACCATCATCATGACCCTCCGCCAGGCCTTTGCCATCCTTCTTTCCTGCCTTCTCTAT
GGCCACACTGTCACTGTGGTGGGAGGGCTGGGGGTGGCTGTGGTCTTTGCTGCCCTCCTGCTCAGAGTC
TACGCGCGGGGCCGTCTAAAGCAACGGGGAAAGAAGGCTGTGCCTGTTGAGTCTCCTGTGCAGAAGGTT
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286520
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286520.1
RefSeq Size 2088 bp
RefSeq ORF 900 bp
Locus ID 347734
UniProt ID Q8TB61
Protein Families Druggable Genome, Transmembrane
MW 32.7 kDa
Gene Summary Sulfotransferases (e.g., SULT4A1; MIM 608359) use an activated form of sulfate, 3-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS), as a common sulfate donor for sulfation of glycoproteins, proteoglycans, and glycolipids in the endoplasmic reticulum and Golgi apparatus. SLC35B2 is located in the microsomal membrane and transports PAPS from the cytosol, where it is synthesized, into the Golgi lumen (Kamiyama et al., 2003 [PubMed 12716889]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (9) uses an alternate splice site that results in translation initiation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (f) is shorter at the N-terminus, compared to isoform a. Both variants 8 and 9 encode isoform f.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...