ARFGAP1 (NM_001281484) Human Untagged Clone

CAT#: SC335144

ARFGAP1 (untagged) - Human ADP-ribosylation factor GTPase activating protein 1 (ARFGAP1), transcript variant 5



  "NM_001281484" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ARFGAP1 mouse monoclonal antibody, clone OTI1F6 (formerly 1F6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARF1GAP; HRIHFB2281
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281484, the custom clone sequence may differ by one or more nucleotides


ATGCTAAGTTCCGAGAGTTCCTGGAGTCTCAGGAGGATTACGATCCTTGCTGGTCCTTGCAGGAGAAGTA
CAACAGCAGAGCCGCGGCCCTCTTTAGGGATAAGAGTCTCTGGCCAGCCGCAGAGTGTGACCGCCTCCTC
GGACAAGGCTTTTGAAGACTGGCTGAATGATGACCTCGGCTCCTATCAAGGGGCCCAGGGGAATCGCTAC
GTGGGGTTTGGGAACACGCCACCGCCTCAGAAGAAAGAAGATGACTTCCTCAACAACGCCATGTCCTCCC
TGTACTCGGGCTGGAGCAGCTTCACCACTGGAGCCAGCCGGTTTGCCTCGGCAGCCAAGGAGGGCGCTAC
AAAGTTTGGATCCCAAGCGAGTCAGAAGGCGTCCGAGCTGGGCCACAGCCTGAACGAGAACGTCCTCAAG
CCTGCGCAGGAGAAGGTGAAGGAGGGAAAGATTTTTGATGATGTCTCCAGTGGGGTCTCTCAGTTGGCGT
CCAAGGTCCAGGGAGTCGGTAGTAAGGGATGGCGGGACGTCACCACCTTTTTTTCGGGGAAAGCAGAGGG
CCCCTTGGACAGCCCCTCGGAGGGCCACAGTTATCAGAACAGCGGTCTGGACCACTTCCAAAACAGCAAC
ATAGACCAGAGCTTCTGGGAGACCTTTGGAAGTGCTGAGCCCACCAAGACCCGCAAGTCCCCGAGCAGCG
ACAGCTGGACGTGCGCGGACACCTCCACCGAGAGGAGGAGCTCGGACAGCTGGGAGGTGTGGGGCTCGGC
CTCCACCAACAGGAACAGCAACAGCGACGGCGGGGAGGGCGGGGAGGGCACCAAGAAGGCAGTGCCGCCG
GCCGTGCCCACTGATGATGGCTGGGACAACCAGAACTGGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001281484
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001281484.1, NP_001268413.1
RefSeq Size 3184 bp
RefSeq ORF 882 bp
Locus ID 55738
UniProt ID Q8N6T3
Protein Pathways Endocytosis
Gene Summary The protein encoded by this gene is a GTPase-activating protein, which associates with the Golgi apparatus and which interacts with ADP-ribosylation factor 1. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1-bound GTP and is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is required for the fusion of these vesicles with target compartments. The activity of this protein is stimulated by phosphoinosides and inhibited by phosphatidylcholine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (5) lacks two exons in the 5' and central coding region, and initiates translation at an alternate start codon, compared to variant 2. The encoded isoform (e) is shorter and has a distinct N-terminus, compared to isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...