ARFGAP1 (NM_001281484) Human Untagged Clone
CAT#: SC335144
ARFGAP1 (untagged) - Human ADP-ribosylation factor GTPase activating protein 1 (ARFGAP1), transcript variant 5
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARF1GAP; HRIHFB2281 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001281484, the custom clone sequence may differ by one or more nucleotides
ATGCTAAGTTCCGAGAGTTCCTGGAGTCTCAGGAGGATTACGATCCTTGCTGGTCCTTGCAGGAGAAGTA CAACAGCAGAGCCGCGGCCCTCTTTAGGGATAAGAGTCTCTGGCCAGCCGCAGAGTGTGACCGCCTCCTC GGACAAGGCTTTTGAAGACTGGCTGAATGATGACCTCGGCTCCTATCAAGGGGCCCAGGGGAATCGCTAC GTGGGGTTTGGGAACACGCCACCGCCTCAGAAGAAAGAAGATGACTTCCTCAACAACGCCATGTCCTCCC TGTACTCGGGCTGGAGCAGCTTCACCACTGGAGCCAGCCGGTTTGCCTCGGCAGCCAAGGAGGGCGCTAC AAAGTTTGGATCCCAAGCGAGTCAGAAGGCGTCCGAGCTGGGCCACAGCCTGAACGAGAACGTCCTCAAG CCTGCGCAGGAGAAGGTGAAGGAGGGAAAGATTTTTGATGATGTCTCCAGTGGGGTCTCTCAGTTGGCGT CCAAGGTCCAGGGAGTCGGTAGTAAGGGATGGCGGGACGTCACCACCTTTTTTTCGGGGAAAGCAGAGGG CCCCTTGGACAGCCCCTCGGAGGGCCACAGTTATCAGAACAGCGGTCTGGACCACTTCCAAAACAGCAAC ATAGACCAGAGCTTCTGGGAGACCTTTGGAAGTGCTGAGCCCACCAAGACCCGCAAGTCCCCGAGCAGCG ACAGCTGGACGTGCGCGGACACCTCCACCGAGAGGAGGAGCTCGGACAGCTGGGAGGTGTGGGGCTCGGC CTCCACCAACAGGAACAGCAACAGCGACGGCGGGGAGGGCGGGGAGGGCACCAAGAAGGCAGTGCCGCCG GCCGTGCCCACTGATGATGGCTGGGACAACCAGAACTGGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281484 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001281484.1, NP_001268413.1 |
RefSeq Size | 3184 bp |
RefSeq ORF | 882 bp |
Locus ID | 55738 |
UniProt ID | Q8N6T3 |
Protein Pathways | Endocytosis |
Gene Summary | The protein encoded by this gene is a GTPase-activating protein, which associates with the Golgi apparatus and which interacts with ADP-ribosylation factor 1. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1-bound GTP and is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is required for the fusion of these vesicles with target compartments. The activity of this protein is stimulated by phosphoinosides and inhibited by phosphatidylcholine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (5) lacks two exons in the 5' and central coding region, and initiates translation at an alternate start codon, compared to variant 2. The encoded isoform (e) is shorter and has a distinct N-terminus, compared to isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237250 | ARFGAP1 (myc-DDK-tagged) - Human ADP-ribosylation factor GTPase activating protein 1 (ARFGAP1), transcript variant 5 |
CNY 3,990.00 |
|
RG237250 | ARFGAP1 (tGFP-tagged) - Human ADP-ribosylation factor GTPase activating protein 1 (ARFGAP1), transcript variant 5 |
CNY 4,370.00 |
其它ARFGAP1产品