RITA (RITA1) (NM_001286215) Human Untagged Clone

CAT#: SC335142

RITA1 (untagged) - Human RBPJ interacting and tubulin associated 1 (RITA1), transcript variant 2



  "NM_001286215" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RITA1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C12orf52; RITA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286215, the custom clone sequence may differ by one or more nucleotides


ATGCTCAGGGAGCCTCGGAAGCAGGGCCTGGCCGGCAGAGCACACCTGCTGTCACCAGGGACCACAGGCA
GCATGAAGACCCCCGTGGAGCTGGCCGTCAGTGGGATGCAGACCCTCGGCCTTCAGCACCGCTGCCGAGG
TGGCTACCGGGTCAAGGCCAGGACGTCATATGTGGATGAGACTCTGTTTGGCAGCCCAGCAGGCACCCGG
CCTACCCCACCGGACTTCGATCCGCCCTGGGTGGAGAAGGCTAACAGAACCAGAGGCGTGGGCAAGGAGG
CATCGAAGGCCTTGGGGGCAAAGGGGAGCTGTGAGACCACCCCCTCAAGGGGCAGCACCCCCACCCTCAC
ACCAAGGAAGAAGAACAAATACAGACCCATCAGCCACACCCCGTCTTACTGTGATGAGTCGCTGTTTGGC
TCCCGATCTGAAGGCGCCAGCTTCGGGGCCCCGCGGATGGCGAAGGGGGATGCCGCAAAGCTCCGTGCTC
TCTTGTGGACGCCACCACCTACCCCCAGGGGTAGCCACTCGCCCCGCCCCAGGGAGGCACCACTGCGAGC
CATTCACCCAGCTGGTCCCTCCAAGACAGAGCCGGGGCCAGCGGCAGACTCCCAGAAGTTATCTATGGGT
GGGTTACACTCTTCACGCCCCCTGAAGCGGGGACTTTCCCATTCCCTCACCCACCTGAATGTCCCCAGCA
CTGGTCATCCAGCCACCAGTGCCCCCCACACAAATGGGCCTCAGGATCTCAGGCCTTCCACGTCAGGGGT
GACCTTCCGGAGCCCCCTGGTGACTTCCAGGGCTCGCTCAGTTAGCATTTCAGTGCCATCTACCCCACGA
CGAGGTGGGGCCACCCAGAAACCAAAGCCCCCTTGGAAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001286215
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286215.1, NP_001273144.1
RefSeq Size 1921 bp
RefSeq ORF 882 bp
Locus ID 84934
UniProt ID Q96K30
Gene Summary Tubulin-binding protein that acts as a negative regulator of Notch signaling pathway. Shuttles between the cytoplasm and the nucleus and mediates the nuclear export of RBPJ/RBPSUH, thereby preventing the interaction between RBPJ/RBPSUH and NICD product of Notch proteins (Notch intracellular domain), leading to down-regulate Notch-mediated transcription. May play a role in neurogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate exon in the 5' region and initiates translation at an alternate upstream start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...