PPP2R2D (NM_001291310) Human Untagged Clone

CAT#: SC335113

PPP2R2D (untagged) - Human protein phosphatase 2, regulatory subunit B, delta (PPP2R2D), transcript variant 3



  "NM_001291310" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-Ppp2r2d Antibody
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B55D; B55delta; MDS026
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291310, the custom clone sequence may differ by one or more nucleotides


ATGGATCTTATGGTAGAAGCGAGTCCACGGCGAATTTTTGCAAATGCTCACACATATCATATAAATTCCA
TTTCAGTAAATAGTGATCATGAAACATATCTTTCTGCAGATGACCTGAGAATTAATTTATGGCACTTAGA
AATCACAGATAGAAGCTTTAACATCGTGGACATCAAGCCTGCTAACATGGAGGAGCTGACCGAAGTCATC
ACTGCAGCCGAGTTCCACCCGCACCAGTGCAACGTGTTCGTCTACAGCAGTAGCAAAGGGACCATCCGCC
TGTGTGACATGCGCTCCTCGGCCCTGTGCGACAGACACTCCAAGTTTTTTGAAGAGCCTGAAGATCCCAG
CAGTAGGTCCTTCTTCTCAGAAATAATTTCATCCATATCCGATGTAAAATTCAGTCATAGTGGGCGGTAC
ATGATGACCAGAGACTACCTGTCGGTGAAGGTGTGGGACCTCAACATGGAGAGCAGGCCGGTGGAGACCC
ACCAGGTCCACGAGTACCTGCGCAGCAAGCTCTGCTCTCTCTATGAGAACGACTGCATCTTTGACAAGTT
TGAGTGTTGCTGGAACGGTTCGGATAGCGCCATCATGACCGGGTCCTATAACAACTTCTTCAGGATGTTT
GATAGAGACACGCGGAGGGATGTGACCCTGGAGGCCTCGAGAGAGAGCAGCAAACCGCGCGCCAGCCTCA
AACCCCGGAAGGTGTGTACGGGGGGTAAGCGGAGGAAAGACGAGATCAGTGTGGACAGTCTGGACTTCAA
CAAGAAGATCCTGCACACAGCCTGGCACCCCGTGGACAATGTCATTGCCGTGGCTGCCACCAATAACTTG
TACATATTCCAGGACAAAATCAACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001291310
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291310.1, NP_001278239.1
RefSeq Size 6791 bp
RefSeq ORF 867 bp
Locus ID 55844
UniProt ID Q66LE6
Protein Families Druggable Genome, Phosphatase
Protein Pathways Tight junction
Gene Summary B regulatory subunit of protein phosphatase 2A (PP2A) that plays a key role in cell cycle by controlling mitosis entry and exit. The activity of PP2A complexes containing PPP2R2D (PR55-delta) fluctuate during the cell cycle: the activity is high in interphase and low in mitosis. During mitosis, activity of PP2A is inhibited via interaction with phosphorylated ENSA and ARPP19 inhibitors. Within the PP2A complexes, the B regulatory subunits modulate substrate selectivity and catalytic activity, and also may direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains an additional exon in the 5' region, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...