Thrombopoietin (THPO) (NM_001289997) Human Untagged Clone

CAT#: SC335099

THPO (untagged) - Human thrombopoietin (THPO), transcript variant 4



  "NM_001289997" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-THPO Antibody - middle region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MGDF; MKCSF; ML; MPLLG; THCYT1; TPO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289997, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTGACTGAATTGCTCCTCGTGGTCATGCTTCTCCTAACTGCAAGGCTAACGCTGTCCAGCCCGG
CTCCTCCTGCTTGTGACCTCCGAGTCCTCAGTAAACTGCTTCGTGACTCCCATGTCCTTCACAGCAGACT
GAGCCAGTGCCCAGAGGTTCACCCTTTGCCTACACCTGTCCTGCTGCCTGCTGTGGACTTTAGCTTGGGA
GAATGGAAAACCCAGATGGAGGAGACCAAGGCACAGGACATTCTGGGAGCAGTGACCCTTCTGCTGGAGG
GAGTGATGGCAGCACGGGGACAACTGGGACCCACTTGCCTCTCATCCCTCCTGGGGCAGCTTTCTGGACA
GGTCCGTCTCCTCCTTGGGGCCCTGCAGAGCCTCCTTGGAACCCAGCTTCCTCCACAGGGCAGGACCACA
GCTCACAAGGATCCCAATGCCATCTTCCTGAGCTTCCAACACCTGCTCCGAGGAAAGGACTTCTGGATTG
TTGGAGACAAACTTCACTGCCTCAGCCAGAACTACTGGCTCTGGGCTTCTGAAGTGGCAGCAGGGATTCA
GAGCCAAGATTCCTGGTCTGCTGAACCAAACCTCCAGGTCCCTGGACCAAATCCCCGGATACCTGAACAG
GATACACGAACTCTTGAATGGAACTCGTGGACTCTTTCCTGGACCCTCACGCAGGACCCTAGGAGCCCCG
GACATTTCCTCAGGAACATCAGACACAGGCTCCCTGCCACCCAACCTCCAGCCTGGATATTCTCCTTCCC
CAACCCATCCTCCTACTGGACAGTATACGCTCTTCCCTCTTCCACCCACCTTGCCCACCCCTGTGGTCCA
GCTCCACCCCCTGCTTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001289997
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289997.1, NP_001276926.1
RefSeq Size 1807 bp
RefSeq ORF 861 bp
Locus ID 7066
UniProt ID P40225
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Hematopoietic cell lineage
Gene Summary Megakaryocytopoiesis is the cellular development process that leads to platelet production. The main functional protein encoded by this gene is a humoral growth factor that is necessary for megakaryocyte proliferation and maturation, as well as for thrombopoiesis. This protein is the ligand for MLP/C_MPL, the product of myeloproliferative leukemia virus oncogene. Mutations in this gene are the cause of thrombocythemia 1. Alternative promoter usage and differential splicing result in multiple transcript variants differing in the 5' UTR and/or coding region. Multiple AUG codons upstream of the main open reading frame (ORF) have been identified, and these upstream AUGs inhibit translation of the main ORF at different extent. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (4) represents use of the downstream promoter and comprises six exons. It lacks an internal segment in the 3' exon, which results in a frameshift, compared to variant 1. The resulting isoform (4) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...