GAS8 (NM_001286208) Human Untagged Clone

CAT#: SC335097

GAS8 (untagged) - Human growth arrest-specific 8 (GAS8), transcript variant 4



  "NM_001286208" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
GAS8 mouse monoclonal antibody, clone OTI10G2 (formerly 10G2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CILD33; DRC4; GAS11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286208, the custom clone sequence may differ by one or more nucleotides


ATGAAGATGCTGAGGGACGAACTCGACTTGCGGAGAAAGACTGAGCTCCACGAAGTGGAGGAGAGGAAGA
ATGGCCAGATCCACACGCTGATGCAGCGCCACGAGGAGGCCTTCACCGACATTAAGAACTACTACAACGA
CATCACCCTCAACAACCTGGCCCTCATCAACTCCCTCAAGGAGCAGATGGAGGACATGCGGAAGAAGGAG
GACCACCTGGAGAGGGAGATGGCAGAGGTGTCTGGGCAGAACAAGCGCCTGGCAGACCCTCTCCAGAAGG
CTCGGGAGGAGATGAGCGAGATGCAGAAACAGCTCGCAAACTACGAGAGGGACAAGCAGATCCTGCTTTG
CACAAAAGCCCGTTTGAAAGTCAGGGAGAAAGAGCTGAAAGACCTGCAGTGGGAGCATGAAGTGTTAGAG
CAGCGATTCACCAAGGTGCAGCAGGAGCGGGACGAGCTCTATCGGAAGTTCACCGCAGCCATCCAGGAGG
TGCAGCAGAAGACAGGGTTCAAGAACCTCGTGCTAGAACGCAAGCTGCAGGCTCTGAGCGCCGCTGTGGA
GAAGAAGGAGGTGCAGTTCAACGAGGTCCTGGCTGCCTCTAACCTGGACCCTGCAGCCCTGACGCTGGTG
TCCCGCAAGCTGGAGGATGTTCTTGAGTCGAAGAACAGCACCATCAAGGACCTGCAGTATGAGCTGGCCC
AGGTCTGTAAGGCCCATAACGACCTGCTGCGCACGTATGAGGCAAAGCTGCTGGCCTTCGGGATCCCTCT
GGACAACGTGGGCTTCAAGCCCTTGGAAACAGCTGTGATCGGACAGACACTGGGCCAGGGCCCCGCGGGA
CTGGTGGGCACCCCGACGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001286208
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286208.1, NP_001273137.1
RefSeq Size 3253 bp
RefSeq ORF 861 bp
Locus ID 2622
UniProt ID O95995
Gene Summary This gene includes 11 exons spanning 25 kb and maps to a region of chromosome 16 that is sometimes deleted in breast and prostrate cancer. The second intron contains an apparently intronless gene, C16orf3, that is transcribed in the opposite orientation. This gene is a putative tumor suppressor gene. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (4) uses an alternate splice site at the 5' end of an exon and lacks an alternate internal exon compared to variant 1. The resulting isoform (c) is shorter at the N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...