DMC1 (NM_001278208) Human Untagged Clone

CAT#: SC335082

DMC1 (untagged) - Human DNA meiotic recombinase 1 (DMC1), transcript variant 2



  "NM_001278208" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to DMC1 (DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast))
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ199H16.1; DMC1H; LIM15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278208, the custom clone sequence may differ by one or more nucleotides


ATGAAGGAGGATCAAGTTGTGGCGGAAGAACCAGGATTCCAAGATGAAGAGGAATCTTTGTTTCAAGATA
TTGACCTGTTACAGAAACATGGAATTAACGTGGCTGACATTAAGAAACTGAAATCAGTAGGAATCTGTAC
CATCAAAGGTATACAGATGACAACAAGAAGAGCTCTATGCAATGTCAAAGGACTCTCAGAAGCCAAAGTA
GACAAGATTAAAGAGGCAGCGAACAAACTAATTGAACCAGGATTCTTGACTGCATTTGAGTATAGTGAAA
AGAGGAAAATGGTTTTCCATATCACCACCGGGAGCCAGGAATTTGATAAGTTACTAGGAGGTGGAATTGA
AAGTATGGCAATTACAGAAGCTTTTGGAGAATTTCGTACTGGAAAAACCCAGCTTTCTCATACCCTCTGT
GGTGAACATCAGATGGAGCTACTTGATTATGTAGCAGCAAAGTTCCATGAAGAAGCTGGCATCTTCAAGC
TATTGATTATCGATTCAATAATGGCACTTTTTCGAGTGGATTTCAGTGGCCGTGGGGAGTTGGCCGAACG
GCAGCAAAAATTGGCCCAGATGTTGTCACGACTCCAAAAAATCTCAGAAGAATATAACGTGGCTGTTTTT
GTGACCAATCAAATGACTGCCGATCCAGGAGCAACTATGACCTTTCAGGCAGATCCCAAAAAACCCATTG
GGGGACACATTCTGGCTCATGCTTCAACAACAAGAATAAGCTTGCGAAAGGGAAGAGGAGAGCTCAGAAT
TGCCAAGATTTATGACAGTCCTGAGATGCCTGAAAATGAAGCCACCTTCGCAATAACTGCTGGAGGAATT
GGGGATGCCAAGGAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001278208
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278208.1, NP_001265137.1
RefSeq Size 2082 bp
RefSeq ORF 858 bp
Locus ID 11144
UniProt ID Q14565
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the superfamily of recombinases (also called DNA strand-exchange proteins). Recombinases are important for repairing double-strand DNA breaks during mitosis and meiosis. This protein, which is evolutionarily conserved, is reported to be essential for meiotic homologous recombination and may thus play an important role in generating diversity of genetic information. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks two alternate in-frame exons in the coding region compared to variant 1. The resulting protein (isoform 2) lacks an internal portion compared to isoform 1. Variants 2 and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...