CGK2 (PRKG2) (NM_001282483) Human Untagged Clone
CAT#: SC335052
PRKG2 (untagged) - Human protein kinase, cGMP-dependent, type II (PRKG2), transcript variant 5
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
PRKG2 mouse monoclonal antibody,clone OTI10D5
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | cGK2; cGKII; PKG2; PRKGR2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282483, the custom clone sequence may differ by one or more nucleotides
ATGAAGTGTATAAGGAAGAAGCACATAGTTGACACCAAGCAGCAGGAGCATGTCTACTCAGAGAAGAGGA TCCTAGAGGAGCTGTGCTCTCCATTCATTGTGAAATTATATCGTACTTTCAAGGACAATAAGTATGTATA CATGCTTCTGGAGGCCTGCTTAGGTGGGGAGCTCTGGAGTATATTAAGGGACAGAGGCAGCTTTGATGAA CCCACCTCCAAATTCTGCGTTGCTTGTGTGACAGAAGCATTTGATTACCTGCATCGACTAGGTATTATCT ACAGAGACTTGAAACCAGAAAACTTAATTCTAGATGCTGAGGGTTACCTTAAATTGGTTGACTTTGGATT TGCGAAGAAAATAGGGTCTGGACAGAAAACATGGACATTCTGTGGGACTCCAGAATATGTAGCTCCTGAA GTCATTCTCAACAAGGGACATGACTTCAGTGTGGATTTCTGGTCACTGGGAATTCTAGTGTATGAGCTCC TAACGGGCAACCCACCCTTTTCTGGGGTTGACCAAATGATGACCTACAATTTGATTCTCAAAGGAATTGA AAAAATGGATTTTCCCAGGAAGATAACACGACGACCTGAGGATTTGATTCGGAGGCTTTGCAGGCAAAAT CCAACAGAAAGGCTGGGAAATCTGAAGAATGGAATAAATGACATTAAGAAACACAGGTGGTTAAATGGTT TTAATTGGGAGGGACTGAAAGCACGGAGCCTTCCATCACCTTTGCAAAGAGAGCTCAAGGGACCCATAGA TCACAGCTACTTTGACAAATATCCTCCTGAAAAGGGAATGCCTCCAGATGAGCTATCAGGCTGGGATAAA GACTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282483 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282483.1, NP_001269412.1 |
RefSeq Size | 3748 bp |
RefSeq ORF | 849 bp |
Locus ID | 5593 |
UniProt ID | Q13237 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Gap junction, Long-term depression, Olfactory transduction |
Gene Summary | This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein binds to and inhibits the activation of several receptor tyrosine kinases. The membrane-bound protein is a regulator of intestinal secretion, bone growth and renin secretion. Alternate splicing results in multiple transcript variants encoding distinct isoforms whose regulatory N-termini differ in length but whose C-terminal catalytic domains are identical. [provided by RefSeq, May 2018] Transcript Variant: This variant (5) represents the use of an alternate promoter, and has multiple differences compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon compared to variant 1. The resulting isoform (d) has a shorter N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...