G protein alpha 13 (GNA13) (NM_001282425) Human Untagged Clone
CAT#: SC335044
GNA13 (untagged) - Human guanine nucleotide binding protein (G protein), alpha 13 (GNA13), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | G13 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282425, the custom clone sequence may differ by one or more nucleotides
ATGAGGGTGCTGGTTGATGCTCGAGAGAAGCTTCATATTCCCTGGGGAGACAACTCAAACCAACAACATG GAGATAAGATGATGTCGTTTGATACCCGGGCCCCCATGGCAGCCCAAGGAATGGTGGAAACAAGGGTTTT CTTACAATATCTTCCTGCTATAAGAGCATTATGGGCAGACAGCGGCATACAGAATGCCTATGACCGGCGT CGAGAATTTCAACTGGGTGAATCTGTAAAATATTTCCTGGATAACTTGGATAAACTTGGAGAACCAGATT ATATTCCATCACAACAAGATATTCTGCTTGCCAGAAGACCCACCAAAGGCATCCATGAATACGACTTTGA AATAAAAAATGTTCCTTTCAAAATGGTTGATGTAGGTGGTCAGAGATCAGAAAGGAAACGTTGGTTTGAA TGTTTCGACAGTGTGACATCAATACTTTTCCTTGTTTCCTCAAGTGAATTTGACCAGGTGCTTATGGAAG ATCGACTGACCAATCGCCTTACAGAGTCTCTGAACATTTTTGAAACAATCGTCAATAACCGGGTTTTCAG CAATGTCTCCATAATTCTGTTCTTAAACAAGACAGACTTGCTTGAGGAGAAGGTGCAAATTGTGAGCATC AAAGACTATTTCCTAGAATTTGAAGGGGATCCCCACTGCTTAAGAGACGTCCAAAAATTCCTGGTGGAAT GTTTCCGGAACAAACGCCGGGACCAGCAACAGAAGCCCTTATACCACCACTTCACCACTGCTATCAACAC GGAGAACATCCGCCTTGTTTTCCGTGACGTGAAGGATACTATTCTGCATGACAACCTCAAGCAGCTTATG CTACAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282425 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282425.1, NP_001269354.1 |
RefSeq Size | 6016 bp |
RefSeq ORF | 849 bp |
Locus ID | 10672 |
UniProt ID | Q14344 |
Protein Families | Druggable Genome |
Protein Pathways | Long-term depression, Regulation of actin cytoskeleton, Vascular smooth muscle contraction |
Gene Summary | Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems (PubMed:15240885, PubMed:16787920, PubMed:16705036, PubMed:27084452). Activates effector molecule RhoA by binding and activating RhoGEFs (ARHGEF1/p115RhoGEF, ARHGEF11/PDZ-RhoGEF and ARHGEF12/LARG) (PubMed:15240885, PubMed:12515866). GNA13-dependent Rho signaling subsequently regulates transcription factor AP-1 (activating protein-1) (By similarity). Promotes tumor cell invasion and metastasis by activating RhoA/ROCK signaling pathway (PubMed:16787920, PubMed:16705036, PubMed:27084452). Inhibits CDH1-mediated cell adhesion in process independent from Rho activation (PubMed:11976333).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate 5' terminal exon which results in the use of a downstream AUG compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237150 | GNA13 (myc-DDK-tagged) - Human guanine nucleotide binding protein (G protein), alpha 13 (GNA13), transcript variant 2 |
CNY 3,990.00 |
|
RG237150 | GNA13 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), alpha 13 (GNA13), transcript variant 2 |
CNY 4,370.00 |
其它G protein alpha 13产品