G protein alpha 13 (GNA13) (NM_001282425) Human Untagged Clone

CAT#: SC335044

GNA13 (untagged) - Human guanine nucleotide binding protein (G protein), alpha 13 (GNA13), transcript variant 2



  "NM_001282425" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-GNA13 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms G13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282425, the custom clone sequence may differ by one or more nucleotides


ATGAGGGTGCTGGTTGATGCTCGAGAGAAGCTTCATATTCCCTGGGGAGACAACTCAAACCAACAACATG
GAGATAAGATGATGTCGTTTGATACCCGGGCCCCCATGGCAGCCCAAGGAATGGTGGAAACAAGGGTTTT
CTTACAATATCTTCCTGCTATAAGAGCATTATGGGCAGACAGCGGCATACAGAATGCCTATGACCGGCGT
CGAGAATTTCAACTGGGTGAATCTGTAAAATATTTCCTGGATAACTTGGATAAACTTGGAGAACCAGATT
ATATTCCATCACAACAAGATATTCTGCTTGCCAGAAGACCCACCAAAGGCATCCATGAATACGACTTTGA
AATAAAAAATGTTCCTTTCAAAATGGTTGATGTAGGTGGTCAGAGATCAGAAAGGAAACGTTGGTTTGAA
TGTTTCGACAGTGTGACATCAATACTTTTCCTTGTTTCCTCAAGTGAATTTGACCAGGTGCTTATGGAAG
ATCGACTGACCAATCGCCTTACAGAGTCTCTGAACATTTTTGAAACAATCGTCAATAACCGGGTTTTCAG
CAATGTCTCCATAATTCTGTTCTTAAACAAGACAGACTTGCTTGAGGAGAAGGTGCAAATTGTGAGCATC
AAAGACTATTTCCTAGAATTTGAAGGGGATCCCCACTGCTTAAGAGACGTCCAAAAATTCCTGGTGGAAT
GTTTCCGGAACAAACGCCGGGACCAGCAACAGAAGCCCTTATACCACCACTTCACCACTGCTATCAACAC
GGAGAACATCCGCCTTGTTTTCCGTGACGTGAAGGATACTATTCTGCATGACAACCTCAAGCAGCTTATG
CTACAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282425
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282425.1, NP_001269354.1
RefSeq Size 6016 bp
RefSeq ORF 849 bp
Locus ID 10672
UniProt ID Q14344
Protein Families Druggable Genome
Protein Pathways Long-term depression, Regulation of actin cytoskeleton, Vascular smooth muscle contraction
Gene Summary Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems (PubMed:15240885, PubMed:16787920, PubMed:16705036, PubMed:27084452). Activates effector molecule RhoA by binding and activating RhoGEFs (ARHGEF1/p115RhoGEF, ARHGEF11/PDZ-RhoGEF and ARHGEF12/LARG) (PubMed:15240885, PubMed:12515866). GNA13-dependent Rho signaling subsequently regulates transcription factor AP-1 (activating protein-1) (By similarity). Promotes tumor cell invasion and metastasis by activating RhoA/ROCK signaling pathway (PubMed:16787920, PubMed:16705036, PubMed:27084452). Inhibits CDH1-mediated cell adhesion in process independent from Rho activation (PubMed:11976333).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate 5' terminal exon which results in the use of a downstream AUG compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...