UGT2B10 (NM_001290091) Human Untagged Clone
CAT#: SC335030
UGT2B10 (untagged) - Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UDPGT2B10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001290091, the custom clone sequence may differ by one or more nucleotides
ATGAGGAAAGCTGACATATGGCTTATGCGAAACTCCTGGAATTTTAAATTTCCTCATCCATTCTTACCAA ATGTTGATTTTGTTGGAGGACTCCACTGCAAACCTGCCAAACCCCTACCTAAGGAAATGGAGGAGTTTGT ACAGAGCTCTGGAGAAAATGGTGTTGTGGTGTTTTCTCTGGGGTCAATGGTCAGTAACATGACAGAAGAA AGGGCCAACGTAATTGCAACAGCCCTTGCCAAGATCCCACAAAAGGTTCTTTGGAGATTTGATGGGAATA AACCAGATGCCTTAGGTCTCAATACTCGACTGTACAAGTGGATACCCCAGAATGACCTTCTAGGTCATCC AAAAACCAGAGCTTTTATAACTCATGGTGGAGCCAATGGCATCTATGAGGCAATCTACCATGGGATCCCT ATGGTGGGCATTCCATTGTTTTTTGATCAACCTGATAATATTGCTCACATGAAGGCCAAGGGAGCAGCTG TTAGAGTGGACTTCAACACAATGTCGAGTACAGACCTGCTGAATGCACTGAAGACAGTAATTAATGATCC TTCATATAAAGAGAATATTATGAAATTATCAAGAATTCAACATGATCAACCAGTGAAGCCCCTGGATCGA GCAGTCTTCTGGATTGAATTTGTCATGCGCCACAAAGGAGCCAAACATCTTCGAGTTGCAGCCCACAACC TCACCTGGTTCCAGTACCACTCTTTGGATGTGATTGGGTTCCTGCTGGCTTGTGTGGCAACCGTGCTATT TATCATCACAAAGTGTTGTCTGTTTTGTTTCTGGAAGTTTGCTAGAAAAGGAAAGAAGGGAAAAAGGGAT TAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290091 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001290091.1, NP_001277020.1 |
RefSeq Size | 2187 bp |
RefSeq ORF | 843 bp |
Locus ID | 7365 |
UniProt ID | P36537 |
Protein Families | Transmembrane |
Protein Pathways | Androgen and estrogen metabolism, Ascorbate and aldarate metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Pentose and glucuronate interconversions, Porphyrin and chlorophyll metabolism, Retinol metabolism, Starch and sucrose metabolism |
Gene Summary | UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237136 | UGT2B10 (myc-DDK-tagged) - Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 3 |
CNY 3,990.00 |
|
RG237136 | UGT2B10 (tGFP-tagged) - Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 3 |
CNY 4,370.00 |
其它UGT2B10产品