RCBTB2 (NM_001286832) Human Untagged Clone

CAT#: SC335009

RCBTB2 (untagged) - Human regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 (RCBTB2), transcript variant 4



  "NM_001286832" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal antibody to RCBTB2 (regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2)
    • 100 ul

CNY 6,281.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CHC1L; RLG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286832, the custom clone sequence may differ by one or more nucleotides


ATGTCTGGGGTTACAACGGAAACGGGCAGCTTGGACTCGGCAACAGTGGCAACCAGCCAACCCCTTGCAG
AGTGGCAGCTTTGCAAGGCATCCGTGTCCAGAGGGATTATCGAGATTGCAGCCTGTCACTCCACACACAC
GTCTGCGGCCAAGACGCAGGGTGGGCACGTGTACATGTGGGGCCAGTGCCGGGGTCAGTCCGTGATCCTC
CCGCACCTCACCCACTTCTCCTGCACTGACGACGTGTTTGCCTGCTTTGCCACGCCCGCCGTCACGTGGC
GCCTCCTCTCCGTGGAACCTGATGACCACCTCACAGTGGCTGAGTCACTGAAGAGGGAATTTGACAACCC
GGACACTGCAGACCTGAAGTTTCTAGTTGATGGAAAGTACATTTATGCACATAAAGTCCTTCTCAAGATT
CGATGTGAGCATTTTCGTTCGTCATTGGAAGATAACGAGGATGATATTGTAGAAATGAGTGAATTTTCAT
ATCCTGTTTACCGGGCCTTCCTGGAATACCTATACACAGACAGCATCAGCCTTTCTCCTGAGGAGGCAGT
AGGACTGCTAGACTTGGCTACATTTTATAGAGAAAATCGTTTGAAAAAGCTCTGCCAACAAACTATCAAG
CAAGGCATCTGCGAGGAGAATGCCATCGCTCTGCTCTCGGCTGCGGTGAAGTATGATGCACAGGATTTAG
AAGAATTCTGCTTCAGGTTTTGCATAAACCATCTGACTGTAGTAACACAAACATCAGGTTTTGCAGAAAT
GGACCATGATCTCCTGAAGAACTTTATCAGCAAAGCAAGCAGAGTTGGAGCCTTTAAAAATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001286832
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286832.1, NP_001273761.1
RefSeq Size 2658 bp
RefSeq ORF 834 bp
Locus ID 1102
UniProt ID O95199
Gene Summary This gene encodes a protein containing two C-terminal BTB/POZ domains that is related to regulator of chromosome condensation (RCC). The encoded protein may act as a guanine nucleotide exchange factor. This gene is observed to be lost or underexpressed in prostate cancers. There is a pseudogene of this gene on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (4) differs in the 5' UTR, contains multiple differences in the 5' coding region, and initiates translation at an alternate downstream start codon, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. Variants 4, 8, and 9 all encode the same isoform (4).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...