OSCAR (NM_001282350) Human Untagged Clone

CAT#: SC334964

OSCAR (untagged) - Human osteoclast associated, immunoglobulin-like receptor (OSCAR), transcript variant 7



  "NM_001282350" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


OSCAR Antibody - C-terminal region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PIgR-3; PIGR3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282350, the custom clone sequence may differ by one or more nucleotides


ATGGCCCTGGTGCTGATCCTCCAGCTGCTGACCCTCTTCCCCCCAGCTTCATACCACCCTAAGCCATGGC
TGGGAGCTCAGCCGGCTACAGTTGTGACCCCTGGGGTCAACGTGACCTTGAGATGCCGGGCACCCCAACC
CGCTTGGAGATTTGGACTTTTCAAGCCTGGAGAGATCGCTCCCCTTCTCTTCCGGGATGTGTCCTCCGAG
CTGGCAGAATTCTTTCTGGAGGAGGTGACTCCAGCCCAAGGGGGAAGTTACCGCTGCTGCTACCGAAGGC
CAGACTGGGGGCCGGGTGTCTGGTCCCAGCCCAGCGATGTCCTGGAGCTGCTGGTGACAGAGGAGCTGCC
GCGGCCGTCGCTGGTGGCGCTGCCCGGGCCGGTGGTGGGTCCTGGCGCCAACGTGAGCCTGCGCTGCGCG
GGCCGCCTGCGGAACATGAGCTTCGTGCTGTACCGCGAGGGCGTGGCGGCCCCGCTGCAGTACCGCCACT
CCGCGCAGCCCTGGGCCGACTTCACGCTGCTGGGCGCCCGCGCCCCCGGCACCTACAGCTGCTACTATCA
CACGCCCTCCGCGCCCTACGTGCTGTCGCAGCGCAGCGAGGTGCTGGTCATCAGCTGGGAAGGTGAGGGC
CCTGAGGCCCGGCCCGCCTCCTCCGCCCCAGGAATGCAGGCCCCAGGACCTCCGCCCTCAGACCCAGGAG
CCCAGGCCCCCAGCCTCTCCTCCTTCAGACCCAGGGGTCTAGTCCTGCAGCCCCTCCTCCCTCAGACCCA
GGATTCCTGGGACCCAGCCCCTCCTCCCTCAGATCCAGGAGTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001282350
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282350.1, NP_001269279.1
RefSeq Size 2028 bp
RefSeq ORF 816 bp
Locus ID 126014
UniProt ID Q8IYS5
Protein Families Druggable Genome
Gene Summary Osteoclasts are multinucleated cells that resorb bone and are essential for bone homeostasis. This gene encodes an osteoclast-associated receptor (OSCAR), which is a member of the leukocyte receptor complex protein family that plays critical roles in the regulation of both innate and adaptive immune responses. The encoded protein may play a role in oxidative stress-mediated atherogenesis as well as monocyte adhesion. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (7) lacks two in-frame exons in the central coding region, compared to variant 1. The encoded isoform (7) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...