PDLIM5 (NM_001256425) Human Untagged Clone

CAT#: SC334956

PDLIM5 (untagged) - Human PDZ and LIM domain 5 (PDLIM5), transcript variant 3



  "NM_001256425" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PDLIM5 mouse monoclonal antibody, clone OTI1A11 (formerly 1A11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ENH; ENH1; L9; LIM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001256425, the custom clone sequence may differ by one or more nucleotides


ATGCCCGAGAGCCTGGACAGCCCAACCTCTGGCAGACCAGGGGTTACCAGCCTCACAACTGCAGCTGCCT
TCAAGCCTGTAGGATCCACTGGCGTCATCAAGTCACCAAGCTGGCAACGGCCAAACCAAGGAGTACCTTC
CACTGGAAGAATCTCAAACAGCGCTACTTACTCAGGATCAGTGGCACCAGCCAACTCAGCTTTGGGACAA
ACCCAGCCAAGTGACCAGGACACTTTAGTGCAAAGAGCTGAGCACATTCCAGCAGGGAAACGAACTCCGA
TGTGCGCCCATTGTAACCAGGTCATCAGAGGACCATTCTTAGTGGCACTGGGGAAATCTTGGCACCCAGA
AGAATTCAACTGCGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTAGAGGAGAAAGGAGCCCTG
TATTGTGAGCTGTGCTATGAGAAATTCTTTGCCCCTGAATGTGGTCGATGCCAAAGGAAGATCCTTGGAG
AAGTCATCAGTGCGTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTAGCCTGTGGAAAGCCCAT
TCGGAACAATGTTTTTCACTTGGAGGATGGTGAACCCTACTGTGAGACTGATTATTATGCCCTCTTTGGT
ACTATATGCCATGGATGTGAATTTCCCATAGAAGCTGGTGACATGTTCCTGGAAGCTCTGGGCTACACCT
GGCATGACACTTGCTTTGTATGCTCAGTGTGTTGTGAAAGTTTGGAAGGTCAGACCTTTTTCTCCAAGAA
GGACAAGCCCCTGTGTAAGAAACATGCTCATTCTGTGAATTTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256425
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256425.1, NP_001243354.1
RefSeq Size 5713 bp
RefSeq ORF 816 bp
Locus ID 10611
Protein Families Druggable Genome
Gene Summary This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (3) lacks an alternate exon in the 5' coding region and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...