Cyclin H (CCNH) (NM_001199189) Human Untagged Clone
CAT#: SC334952
CCNH (untagged) - Human cyclin H (CCNH), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAK; CycH; p34; p37 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001199189, the custom clone sequence may differ by one or more nucleotides
ATGACACTCTGCAAATACTATGAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAA GATCTGTTGTGGGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCA CCCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTATCTAGTCCT CAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTTGAACAGATACTGGAATATG AACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTCCACAATCCTTACAGACCATTTGAGGGCTT CCTCATCGACTTAAAGACCCGCTATCCCATATTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGAC TTTCTTAATAGAATTGCATTGACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCA TTTTATCTAGTGCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGA GAACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAGAAGTATGAA CCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGTCATTCTGCTGAGCTTGCAC TTAACGTAATCACGAAGAAGAGGAAAGGCTATGAAGATGATGATTACGTCTCAAAGAAATCCAAACATGA GGAGGAAGAATGGACTGATGACGACCTGGTAGAATCTCTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199189 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199189.1, NP_001186118.1 |
RefSeq Size | 1517 bp |
RefSeq ORF | 813 bp |
Locus ID | 902 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Cell cycle, Nucleotide excision repair |
Gene Summary | The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK7 kinase and ring finger protein MAT1. The kinase complex is able to phosphorylate CDK2 and CDC2 kinases, thus functions as a CDK-activating kinase (CAK). This cyclin and its kinase partner are components of TFIIH, as well as RNA polymerase II protein complexes. They participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery. A pseudogene of this gene is found on chromosome 4. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Nov 2010] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence and the 3' UTR and coding sequence, and initiates translation at a downstream start codon, compared to variant 3. The encoded isoform (2) is shorter at the N-terminus and has a shorter and distinct C-terminus compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...