Caspase 9 (CASP9) (NM_001278054) Human Untagged Clone
CAT#: SC334933
CASP9 (untagged) - Human caspase 9, apoptosis-related cysteine peptidase (CASP9), transcript variant beta
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APAF-3; APAF3; ICE-LAP6; MCH6; PPP1R56 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278054, the custom clone sequence may differ by one or more nucleotides
ATGGACGAAGCGGATCGGCGGCTCCTGCGGCGGTGCCGGCTGCGGCTGGTGGAAGAGCTGCAGGTGGACC AGCTCTGGGACGCCCTGCTGAGCCGCGAGCTGTTCAGGCCCCATATGATCGAGGACATCCAGCGGGCAGG CTCTGGATCTCGGCGGGATCAGGCCAGGCAGCTGATCATAGATCTGGAGACTCGAGGGAGTCAGGCTCTT CCTTTGTTCATCTCCTGCTTAGAGGACACAGGCCAGGACATGCTGGCTTCGTTTCTGCGAACTAACAGGC AAGCAGCAAAGTTGTCGAAGCCAACCCTAGAAAACCTTACCCCAGTGGTGCTCAGACCAGAGATTCGCAA ACCAGAGGTTCTCAGACCGGAAACACCCAGACCAGTGGACATTGGTTCTGGAGGATTTGGTGATGTCGAG CAGAAAGACCATGGGTTTGAGGTGGCCTCCACTTCCCCTGAAGACGAGTCCCCTGGCAGTAACCCCGAGC CAGATGCCACCCCGTTCCAGGAAGGTTTGAGGACCTTCGACCAGCTGGACGCCATATCTAGTTTGCCCAC ACCCAGTGACATCTTTGTGTCCTACTCTACTTTCCCAGGTTTTGTTTCCTGGAGGGACCCCAAGAGTGGC TCCTGGTACGTTGAGACCCTGGACGACATCTTTGAGCAGTGGGCTCACTCTGAAGACCTGCAGTCCCTCC TGCTTAGGGTCGCTAATGCTGTTTCGGTGAAAGGGATTTATAAACAGATGCCTGGTTGCTTTAATTTCCT CCGGAAAAAACTTTTCTTTAAAACATCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278054 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278054.1, NP_001264983.1 |
RefSeq Size | 2588 bp |
RefSeq ORF | 801 bp |
Locus ID | 842 |
UniProt ID | P55211 |
Protein Families | Druggable Genome, Protease, Stem cell - Pluripotency |
Protein Pathways | Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Colorectal cancer, Endometrial cancer, Huntington's disease, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Parkinson's disease, Pathways in cancer, Prostate cancer, Small cell lung cancer, VEGF signaling pathway, Viral myocarditis |
Gene Summary | This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein can undergo autoproteolytic processing and activation by the apoptosome, a protein complex of cytochrome c and the apoptotic peptidase activating factor 1; this step is thought to be one of the earliest in the caspase activation cascade. This protein is thought to play a central role in apoptosis and to be a tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013] Transcript Variant: This variant (beta) lacks several alternate in-frame exons in the coding region compared to variant alpha. It encodes isoform beta (also known as caspase-9S, caspase-9 beta, caspase-9b) which is shorter compared to isoform alpha. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237039 | CASP9 (myc-DDK-tagged) - Human caspase 9, apoptosis-related cysteine peptidase (CASP9), transcript variant beta |
CNY 2,400.00 |
|
RG237039 | CASP9 (tGFP-tagged) - Human caspase 9, apoptosis-related cysteine peptidase (CASP9), transcript variant beta |
CNY 4,370.00 |
其它Caspase 9产品