TSSC4 (NM_001297661) Human Untagged Clone

CAT#: SC334927

TSSC4 (untagged) - Human tumor suppressing subtransferable candidate 4 (TSSC4), transcript variant 5



  "NM_001297661" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


TSSC4 Antibody - N-terminal region
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297661, the custom clone sequence may differ by one or more nucleotides


ATGGCTGAGGCAGGAACAGGCCTCCTCCCAGCCACGGTGCAGCCATTCCATCTGAGAGGCATGAGCTCCA
CCTTCTCCCAGCGCAGCCGTGACATCTTTGACTGCCTGGAGGGGGCGGCCAGACGGGCTCCATCCTCTGT
GGCCCACACCAGCATGAGTGACAACGGAGGCTTCAAGCGGCCCCTAGCGCCCTCAGGCCGGTCTCCAGTG
GAAGGCCTGGGCAGGGCCCATCGGAGCCCTGCCTCACCAAGGGTGCCTCCGGTCCCCGACTACGTGGCAC
ACCCCGAGCGCTGGACCAAGTACAGCCTGGAAGATGTGACCGAGGTCAGCGAGCAGAGCAATCAGGCCAC
CGCCCTGGCCTTCCTGGGCTCCCAGAGCCTGGCTGCCCCCACTGACTGCGTGTCCTCCTTCAACCAGGAT
CCCTCCAGCTGTGGGGAGGGGAGGGTCATCTTCACCAAACCAGTCCGAGGGGTCGAAGCCAGACACGAGA
GGAAGAGGGTCCTGGGGAAGGTGGGAGAGCCAGGCAGGGGCGGCCTTGGGAATCCTGCCACAGACAGGGG
CGAGGGCCCTGTGGAGCTGGCCCATCTGGCCGGGCCCGGGAGCCCAGAGGCTGAGGAGTGGGGCAGCCAC
CATGGAGGCCTGCAGGAGGTGGAGGCACTGTCAGGGTCTGTCCACAGTGGGTCTGTGCCAGGTCTCCCGC
CGGTGGAAACTGTTGGCTTCCATGGCAGCAGGAAGCGGAGTCGAGACCACTTCCGGAACAAGAGCAGCAG
CCCCGAGGACCCAGGTGCTGAGGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001297661
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297661.1, NP_001284590.1
RefSeq Size 1557 bp
RefSeq ORF 798 bp
Locus ID 10078
UniProt ID Q9Y5U2
Protein Families Druggable Genome
Gene Summary This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is located among several imprinted genes; however, this gene, as well as the pan-hematopoietic expression gene (PHEMX), escapes imprinting. This gene may play a role in malignancies and disease that involve this region. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (5) differs in the 5' UTR and lacks an alternate in-frame segment compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...