BARD1 (NM_001282549) Human Untagged Clone
CAT#: SC334920
BARD1 (untagged) - Human BRCA1 associated RING domain 1 (BARD1), transcript variant 5
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282549, the custom clone sequence may differ by one or more nucleotides
ATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGCGC CCGCCATGGAACCGGATGGTCGCGGTGCCTGGGCCCACAGTCGCGCCGCGCTCGACCGCCTGGAGAAGCT GCTGCGCTGCTCGCGTTGTACTAACATTCTGAGAGAGCCTGTGTGTTTAGGAGGATGTGAGCACATCTTC TGTAGTAATTGTGTAAGTGACTGCATTGGAACTGGATGTCCAGTGTGTTACACCCCGGCCTGGATACAAG ACTTGAAGATAAATAGACAACTGGACAGCATGATTCAACTTTGTAGTAAGCTTCGAAATTTGCTACATGA CAATGAGCTGTCAGGGGTAAAAGCATGTCTACGAAGAAAAGTATGTGAACAGGAAGAAAAGTATGAAATT CCTGAAGGTCCACGCAGAAGCAGGCTCAACAGAGAACAGCTGTTGCCAAAGCTGTTTGATGGATGCTACT TCTATTTGTGGGGAACCTTCAAACACCATCCAAAGGACAACCTTATTAAGCTCGTCACTGCAGGTGGGGG CCAGATCCTCAGTAGAAAGCCCAAGCCAGACAGTGACGTGACTCAGACCATCAATACAGTCGCATACCAT GCGAGACCCGATTCTGATCAGCGCTTCTGCACACAGTATATCATCTATGAAGATTTGTGTAATTATCACC CAGAGAGGGTTCGGCAGGGCAAAGTCTGGAAGGCTCCTTCGAGCTGGTTTATAGACTGTGTGATGTCCTT TGAGTTGCTTCCTCTTGACAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282549 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282549.1, NP_001269478.1 |
RefSeq Size | 3984 bp |
RefSeq ORF | 795 bp |
Locus ID | 580 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (5) six consecutively exons in the coding region, compared to variant 1. The resulting isoform (5, also known as epsilon) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...