BARD1 (NM_001282549) Human Untagged Clone

CAT#: SC334920

BARD1 (untagged) - Human BRCA1 associated RING domain 1 (BARD1), transcript variant 5



  "NM_001282549" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-BARD1 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282549, the custom clone sequence may differ by one or more nucleotides


ATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGCGC
CCGCCATGGAACCGGATGGTCGCGGTGCCTGGGCCCACAGTCGCGCCGCGCTCGACCGCCTGGAGAAGCT
GCTGCGCTGCTCGCGTTGTACTAACATTCTGAGAGAGCCTGTGTGTTTAGGAGGATGTGAGCACATCTTC
TGTAGTAATTGTGTAAGTGACTGCATTGGAACTGGATGTCCAGTGTGTTACACCCCGGCCTGGATACAAG
ACTTGAAGATAAATAGACAACTGGACAGCATGATTCAACTTTGTAGTAAGCTTCGAAATTTGCTACATGA
CAATGAGCTGTCAGGGGTAAAAGCATGTCTACGAAGAAAAGTATGTGAACAGGAAGAAAAGTATGAAATT
CCTGAAGGTCCACGCAGAAGCAGGCTCAACAGAGAACAGCTGTTGCCAAAGCTGTTTGATGGATGCTACT
TCTATTTGTGGGGAACCTTCAAACACCATCCAAAGGACAACCTTATTAAGCTCGTCACTGCAGGTGGGGG
CCAGATCCTCAGTAGAAAGCCCAAGCCAGACAGTGACGTGACTCAGACCATCAATACAGTCGCATACCAT
GCGAGACCCGATTCTGATCAGCGCTTCTGCACACAGTATATCATCTATGAAGATTTGTGTAATTATCACC
CAGAGAGGGTTCGGCAGGGCAAAGTCTGGAAGGCTCCTTCGAGCTGGTTTATAGACTGTGTGATGTCCTT
TGAGTTGCTTCCTCTTGACAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282549
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282549.1, NP_001269478.1
RefSeq Size 3984 bp
RefSeq ORF 795 bp
Locus ID 580
Protein Families Druggable Genome
Gene Summary This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (5) six consecutively exons in the coding region, compared to variant 1. The resulting isoform (5, also known as epsilon) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...