HLA-DQB2 (NM_001300790) Human Untagged Clone
CAT#: SC334917
HLA (untagged) - Human major histocompatibility complex, class II, DQ beta 2 (HLA-DQB2), transcript variant 1
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DQB2; HLA-DQB1; HLA-DXB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300790, the custom clone sequence may differ by one or more nucleotides
ATGGCTCTGCAGATCCCTGGAGGCTTTTGGGCAGCAGCTGTGACCGTGATGCTGGTGATGCTGAGCACCC CAGTGGCTGAGGCCAGAGACTTTCCCAAGGATTTCTTGGTCCAGTTTAAGGGCATGTGCTACTTCACCAA CGGGACAGAGCGCGTGCGCGGTGTGGCCAGATACATCTATAACCGCGAGGAGTACGGGCGCTTCGACAGC GACGTTGGGGAGTTCCAGGCGGTGACCGAGCTGGGGCGGAGCATCGAGGACTGGAACAACTATAAGGACT TCTTGGAGCAGGAGCGGGCCGCGGTGGACAAGGTGTGCAGACACAACTACGAGGCGGAGCTGCGCACGAC CTTGCAGCGGCAAGTGGAGCCCACAGTGACCATCTCCCCATCCAGGACAGAGGCCCTCAACCACCACAAC CTGCTGGTCTGCTCGGTGACAGATTTCTATCCAGCCCAGATCAAAGTCCGGTGGTTTCGGAATGACCAGG AGGAGACAGCCGGTGTTGTGTCCACCTCCCTCATTAGGAATGGTGACTGGACCTTCCAGATTCTGGTGAT GCTGGAAATAACTCCCCAGCGTGGAGACATCTACACCTGCCAAGTGGAGCACCCCAGCCTCCAGAGCCCC ATCACCGTGGAGTGGCGGGCTCAGTCTGAATCTGCCCAGAGCAAGATGCTGAGTGGCATTGGAGGCTTCG TGCTGGGGCTGATCTTCCTCGGGCTGGGCCTTATCATCCGTCACAGGGGTCAGAAAGGACCTCGAGGGCC TCCACCAGCAGGACTCCTGCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300790 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300790.1, NP_001287719.1 |
RefSeq Size | 1233 bp |
RefSeq ORF | 795 bp |
Locus ID | 3120 |
Gene Summary | HLA-DQB2 belongs to the family of HLA class II beta chain paralogs. Class II molecules are heterodimers consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. They play a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). Polymorphisms in the alpha and beta chains specify the peptide binding specificity, and typing for these polymorphisms is routinely done for bone marrow transplantation. However this gene, HLA-DQB2, is not routinely typed, as it is not thought to have an effect on transplantation. There is conflicting evidence in the literature and public sequence databases for the protein-coding capacity of HLA-DQB2. Because there is evidence of transcription and an intact ORF, HLA-DQB2 is represented in Entrez Gene and in RefSeq as a protein-coding locus. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
其它HLA-DQB2产品
Customer
Reviews
Loading...