ATP6V0B (NM_001294333) Human Untagged Clone

CAT#: SC334898

ATP6V0B (untagged) - Human ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 3



  "NM_001294333" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Atp6v0b Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATP6F; HATPL; VMA16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001294333, the custom clone sequence may differ by one or more nucleotides


ATGACGGGGCTAGCACTGCTCTACTCCGGGGTCTTCGTGGCCTTCTGGGCCTGCGCGCTGGCCGTGGGAG
TCTGCTACACCATTTTTGATTTGGGCTTCCGCTTTGATGTGGCATGGTTCCTGACGGAGACTTCGCCCTT
CATGTGGTCCAACCTGGGCATTGGCCTAGCTATCTCCCTGTCTGTGGTTGGGGCAGCCTGGGGCATCTAT
ATTACCGGCTCCTCCATCATTGGTGGAGGAGTGAAGGCCCCCAGGATCAAGACCAAGAACCTGGTCAGCA
TCATCTTCTGTGAGGCTGTGGCCATCTACGGCATCATCATGGCAATTGTCATTAGCAACATGGCTGAGCC
TTTCAGTGCCACAGACCCCAAGGCCATCGGCCATCGGAACTACCATGCAGGCTACTCCATGTTTGGGGCT
GGCCTCACCGTAGGCCTGTCTAACCTCTTCTGTGGAGTCTGCGTGGGCATCGTGGGCAGTGGGGCTGCCC
TGGCCGATGCTCAGAACCCCAGCCTCTTTGTAAAGATTCTCATCGTGGAGATCTTTGGCAGCGCCATTGG
CCTCTTTGGGGTCATCGTCGCAATTCTTCAGGTGATGAATCCCCTTGGGAAGCCTCTGTGTCCTTGTCCC
CAACCTAGCCTTACCCTCCTTCTGGAGAAGCTGAAGTGCTCTCCTTCTCTACCTATAACTATAGATTCCC
CCAAACAGCTTCCACCTCCTCATTTCCATCTTCTGGTTTTCTCCTACAGGGGCTCTCTATTTTTGTCTCT
GATTTGGTGTCACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001294333
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001294333.1, NP_001281262.1
RefSeq Size 2068 bp
RefSeq ORF 786 bp
Locus ID 533
Protein Families Transmembrane
Protein Pathways Epithelial cell signaling in Helicobacter pylori infection, Lysosome, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
Gene Summary This gene encodes a portion of the V0 domain of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Activity of this enzyme is necessary for such varied processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (3) contains an alternate segment in the 3' region, which results in a frameshift, compared to variant 1. The encoded isoform (3) has a longer and distinct C-terminus, compared to variant 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...