RNPS1 (NM_001286627) Human Untagged Clone

CAT#: SC334882

RNPS1 (untagged) - Human RNA binding protein S1, serine-rich domain (RNPS1), transcript variant 5



  "NM_001286627" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RNPS1 Antibody - N-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E5.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286627, the custom clone sequence may differ by one or more nucleotides


ATGGCTCCTTCACCTACCAAACGCAAAGACCGCTCAGATGAGAAGTCCAAGGATCGCTCAAAAGATAAAG
GGGCCACCAAGGAGTCGAGTGAGAAGGATCGCGGCCGGGACAAAACCCGAAAGAGGCGCAGCGCTTCCAG
TGGTAGCAGCAGTACCAGGTCTCGGTCCAGCTCGACTTCCAGCTCAGGCTCCAGCACCAGCACTGGCTCA
AGCAGTGGCTCCAGCTCTTCCTCAGCATCCAGCCGCTCAGGAAGCTCCAGCACCTCCCGCAGCTCCAGCT
CTAGCAGCTCTTCTGGCTCTCCAAGTCCTTCTCGGCGCAGACACGACAACAGGAGGCGCTCCCGCTCCAA
ATCCAAACCACCTAAAAGAGATGAAAAGGAGAGGAAAAGGCGGAGCCCATCTCCTAAGCCCACCAAAGTG
CACATTGGGAGACTCACCCGGAATGTGACAAAGGATCACATCATGGAGATATTTTCCACCTATGGGAAAA
TTAAAATGATTGACATGCCCGTGGAAAGGATGCATCCCCATCTGTCCAAAGGCTATGCGTACGTAGAGTT
TGAGAATCCAGATGAAGCCGAGAAGGCGCTGAAGCACATGGATGGAGGTCCCGCTCCCCGAGGCGCAGGT
CCCCCGTGCGCCGGAGATCACGGTCCCCGGGCCGCCGCCGCCACAGGAGCCGCTCCAGCTCCAACTCCTC
CCGATAAACAGGCCACTGAAGCTCTCGCCCCTGTAACTTATACCCCACCCAGCTCAGTTTTGTCACTTTT
CTAG


Restriction Sites SgfI-MluI     
ACCN NM_001286627
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286627.1, NP_001273556.1
RefSeq Size 1921 bp
RefSeq ORF 774 bp
Locus ID 10921
UniProt ID Q15287
Protein Families Transcription Factors
Gene Summary This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. This protein contains many serine residues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (5) lacks two alternate exons compared to variant 2. The resulting isoform (c) has shorter and distinct N- and C-termini compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...