PRAS40 (AKT1S1) (NM_001278160) Human Untagged Clone

CAT#: SC334875

AKT1S1 (untagged) - Human AKT1 substrate 1 (proline-rich) (AKT1S1), transcript variant 5



  "NM_001278160" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
AKT1S1/PRAS40 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Lobe; PRAS40
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278160, the custom clone sequence may differ by one or more nucleotides


ATGGCGTCGGGGCGCCCCGAGGAGCTGTGGGAGGCCGTGGTGGGGGCCGCTGAGCGCTTCCGGGCCCGGA
CTGGCACGGAGCTGGTGCTGCTGACCGCGGCCCCGCCGCCACCACCCCGCCCGGGCCCCTGTGCCTATGC
TGCCCATGGTCGAGGAGCCCTGGCGGAGGCAGCGCGCCGTTGCCTCCACGACATCGCACTGGCCCACAGG
GCTGCCACTGCTGCTCGGCCTCCTGCGCCCCCACCAGCACCACAGCCACCCAGTCCCACACCCAGCCCAC
CCCGGCCTACCCTGGCCAGAGAGGACAACGAGGAGGACGAGGATGAGCCCACAGAGACAGAGACCTCCGG
GGAGCAGCTGGGCATTAGTGATAATGGAGGGCTCTTTGTGATGGATGAGGACGCCACCCTCCAGGACCTT
CCCCCCTTCTGTGAGTCAGACCCCGAGAGTACAGATGATGGCAGCCTGAGCGAGGAGACCCCCGCCGGCC
CCCCCACCTGCTCAGTGCCCCCAGCCTCAGCCCTACCCACACAGCAGTACGCCAAGTCCCTGCCTGTGTC
TGTGCCCGTCTGGGGCTTCAAGGAGAAGAGGACAGAGGCGCGGTCATCAGATGAGGAGAATGGGCCGCCC
TCTTCGCCCGACCTGGACCGCATCGCGGCGAGCATGCGCGCGCTGGTGCTGCGAGAGGCCGAGGACACCC
AGGTCTTCGGGGACCTGCCACGGCCGCGGCTTAACACCAGCGACTTCCAGAAGCTGAAGCGGAAATATTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001278160
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278160.1, NP_001265089.1
RefSeq Size 1849 bp
RefSeq ORF 771 bp
Locus ID 84335
UniProt ID Q96B36
Gene Summary AKT1S1 is a proline-rich substrate of AKT (MIM 164730) that binds 14-3-3 protein (see YWHAH, MIM 113508) when phosphorylated (Kovacina et al., 2003 [PubMed 12524439]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (5) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, 4, and 5 encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...