RBKS (NM_001287580) Human Untagged Clone

CAT#: SC334864

RBKS (untagged) - Human ribokinase (RBKS), transcript variant 2



  "NM_001287580" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RBKS Antibody - N-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RBSK; RK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287580, the custom clone sequence may differ by one or more nucleotides


ATGACGTCCATGGTGTGTAAGGTTGGCAAAGATTCTTTTGGCAATGATTATATAGAAAACTTAAAACAGA
ATGATATTTCTACAGAATTTACATATCAGACTAAAGATGCTGCTACAGGAACTGCTTCTATAATTGTCAA
TAATGAAGGCCAGAATATCATTGTCATAGTGGCTGGAGCAAATTTACTTTTGAATACGGAGGATCTGAGG
GCAGCAGCCAATGTCATTAGCAGAGCCAAAGTCATGGTCTGCCAGCTCGAAATAACTCCAGCAACTTCTT
TGGAAGCCCTAACAATGGCCCGCAGGAGTGGAGTGAAAACCTTGTTCAATCCAGCCCCTGCCATTGCTGA
CCTGGATCCCCAGTTCTACACCCTCTCAGATGTGTTCTGCTGCAATGAAAGTGAGGCTGAGATTTTAACT
GGCCTCACGGTGGGCAGCGCTGCAGATGCTGGGGAGGCTGCATTAGTGCTCTTGAAAAGGGGCTGCCAGG
TGGTAATCATTACCTTAGGGGCTGAAGGATGTGTGGTGCTGTCACAGACAGAACCTGAGCCAAAGCACAT
TCCCACAGAGAAAGTCAAGGCTGTGGATACCACGGGTGCTGGTGACAGCTTTGTGGGAGCTCTGGCCTTC
TACCTGGCTTACTATCCAAATCTGTCCTTGGAAGACATGCTCAACAGATCCAATTTCATTGCAGCAGTCA
GTGTCCAGGCTGCAGGAACACAGTCATCTTACCCTTACAAAAAAGACCTTCCGCTTACTCTGTTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287580
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287580.1, NP_001274509.1
RefSeq Size 2395 bp
RefSeq ORF 768 bp
Locus ID 64080
UniProt ID Q9H477
Protein Families Druggable Genome
Protein Pathways Pentose phosphate pathway
Gene Summary This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (2) differs in its 5' UTR, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...