BPNT1 (NM_001286151) Human Untagged Clone
CAT#: SC334850
BPNT1 (untagged) - Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HEL20; PIP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286151, the custom clone sequence may differ by one or more nucleotides
ATGAGCATATGTTCTTCATTGGCCCGGAAATTCCCCAAACTCACAATTATAGGGGAAGAGGATCTGCCTT CTGAGGAAGTGGATCAAGAGCTGATTGAAGACAGTCAGTGGGAAGAAATACTGAAGCAACCATGCCCATC GCAGTACAGTGCTATTAAAGAAGAAGATCTCGTGGTCTGGGTTGATCCTCTGGATGGAACCAAGGAATAT ACCGAAGGTCTTCTTGACAATGTAACAGTTCTTATTGGAATTGCTTATGAAGGAAAAGCCATAGCAGGAG TTATTAACCAGCCATATTACAACTATGAGGCAGGACCAGATGCTGTGTTGGGGAGGACAATCTGGGGAGT TTTAGGTTTAGGCGCCTTTGGGTTTCAGCTGAAAGAAGTCCCTGCTGGGAAACACATTATCACAACTACT CGATCCCATAGCAACAAGTTGGTTACTGACTGTGTTGCTGCTATGAACCCCGATGCTGTGCTGCGAGTAG GAGGAGCAGGAAATAAGATTATTCAGCTGATTGAAGGCAAAGCCTCTGCTTATGTATTTGCAAGTCCTGG TTGTAAGAAGTGGGATACTTGTGCTCCAGAAGTTATTTTACATGCTGTGGGAGGCAAGTTAACCGATATC CATGGGAATGTTCTTCAGTACCACAAGGATGTGAAGCATATGAACTCTGCAGGAGTCCTGGCCACACTGA GGAATTATGACTACTATGCAAGCCGAGTTCCAGAATCTATTAAAAATGCACTTGTTCCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286151 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286151.1, NP_001273080.1 |
RefSeq Size | 2379 bp |
RefSeq ORF | 762 bp |
Locus ID | 10380 |
UniProt ID | O95861 |
Protein Pathways | Sulfur metabolism |
Gene Summary | BPNT1, also called bisphosphate 3-prime-nucleotidase, or BPntase, is a member of a magnesium-dependent phosphomonoesterase family. Lithium, a major drug used to treat manic depression, acts as an uncompetitive inhibitor of BPntase. The predicted human protein is 92% identical to mouse BPntase. BPntase's physiologic role in nucleotide metabolism may be regulated by inositol signaling pathways. The inhibition of human BPntase may account for lithium-induced nephrotoxicity. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 4 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...