BPNT1 (NM_001286151) Human Untagged Clone

CAT#: SC334850

BPNT1 (untagged) - Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1), transcript variant 4



  "NM_001286151" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Goat Polyclonal Antibody against BPNT1
    • 100 ug

CNY 5,371.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL20; PIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286151, the custom clone sequence may differ by one or more nucleotides


ATGAGCATATGTTCTTCATTGGCCCGGAAATTCCCCAAACTCACAATTATAGGGGAAGAGGATCTGCCTT
CTGAGGAAGTGGATCAAGAGCTGATTGAAGACAGTCAGTGGGAAGAAATACTGAAGCAACCATGCCCATC
GCAGTACAGTGCTATTAAAGAAGAAGATCTCGTGGTCTGGGTTGATCCTCTGGATGGAACCAAGGAATAT
ACCGAAGGTCTTCTTGACAATGTAACAGTTCTTATTGGAATTGCTTATGAAGGAAAAGCCATAGCAGGAG
TTATTAACCAGCCATATTACAACTATGAGGCAGGACCAGATGCTGTGTTGGGGAGGACAATCTGGGGAGT
TTTAGGTTTAGGCGCCTTTGGGTTTCAGCTGAAAGAAGTCCCTGCTGGGAAACACATTATCACAACTACT
CGATCCCATAGCAACAAGTTGGTTACTGACTGTGTTGCTGCTATGAACCCCGATGCTGTGCTGCGAGTAG
GAGGAGCAGGAAATAAGATTATTCAGCTGATTGAAGGCAAAGCCTCTGCTTATGTATTTGCAAGTCCTGG
TTGTAAGAAGTGGGATACTTGTGCTCCAGAAGTTATTTTACATGCTGTGGGAGGCAAGTTAACCGATATC
CATGGGAATGTTCTTCAGTACCACAAGGATGTGAAGCATATGAACTCTGCAGGAGTCCTGGCCACACTGA
GGAATTATGACTACTATGCAAGCCGAGTTCCAGAATCTATTAAAAATGCACTTGTTCCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001286151
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286151.1, NP_001273080.1
RefSeq Size 2379 bp
RefSeq ORF 762 bp
Locus ID 10380
UniProt ID O95861
Protein Pathways Sulfur metabolism
Gene Summary BPNT1, also called bisphosphate 3-prime-nucleotidase, or BPntase, is a member of a magnesium-dependent phosphomonoesterase family. Lithium, a major drug used to treat manic depression, acts as an uncompetitive inhibitor of BPntase. The predicted human protein is 92% identical to mouse BPntase. BPntase's physiologic role in nucleotide metabolism may be regulated by inositol signaling pathways. The inhibition of human BPntase may account for lithium-induced nephrotoxicity. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 4 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...