PRUNE (PRUNE1) (NM_001303243) Human Untagged Clone

CAT#: SC334842

PRUNE (untagged) - Human prune exopolyphosphatase (PRUNE), transcript variant 4



  "NM_001303243" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PRUNE Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DRES-17; DRES17; H-PRUNE; HTCD37; NMIHBA; PRUNE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001303243, the custom clone sequence may differ by one or more nucleotides


ATGAGATTGACCTCCATGCATTATACCAGGCTGGCCAACTCACCCTCATCCTTGTCGACCATCATATCTT
ATCCAAGACTGACCACTGAGCAGATGCTGAGAAAAGACCAGAAGACTATCTATAGACAAGGCGTCAAGGT
GGCCATTAGTGCAATATATATGGATTTGGAGGCCTTTCTGCAGAGGTCTAACCTCCTTGCAGATCTCCAT
GCTTTCTGCCAGGCTCACAGCTATGATGTCCTGGTTGCCATGACTATCTTTTTCAACACTCACAATGAGC
CAGTGCGGCAGTTGGCTATTTTCTGTCCCCATGTGGCACTCCAAACAACGATCTGTGAAGTCCTGGAACG
CTCCCACTCTCCACCCCTGAAGCTGACCCCTGCCTCAAGTACCCACCCTAACCTCCATGCCTATCTTCAA
GGCAACACCCAGGTCTCTCGAAAGAAACTTCTGCCCCTGCTCCAGGAAGCCCTGTCAGCATATTTTGACT
CCATGAAGATCCCTTCAGGACAGCCTGAGACAGCAGATGTGTCCAGGGAGCAAGTGGACAAGGAATTGGA
CAGGGCAAGTAACTCCCTGATTTCTGGCCTGAGTCAAGATGAGGAGGACCCTCCGCTGCCCCCGACGCCC
ATGAACAGCTTGGTGGATGAGTGCCCTCTAGATCAGGGGCTGCCTAAACTCTCTGCTGAGGCCGTCTTCG
AGAAGTGCAGTCAGATCTCACTGTCACAGTCTACCACAGCCTCCCTGTCCAAGAAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001303243
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001303243.1, NP_001290172.1
RefSeq Size 2757 bp
RefSeq ORF 759 bp
Locus ID 58497
UniProt ID Q86TP1
Protein Pathways Purine metabolism
Gene Summary This gene encodes a member of the DHH protein superfamily of phosphoesterases. This protein has been found to function as both a nucleotide phosphodiesterase and an exopolyphosphatase. This protein is believed to stimulate cancer progression and metastases through the induction of cell motility. A pseuodgene has been identified on chromosome 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (4) lacks two alternate exons in the 5' coding region resulting in a distinct 5' UTR and the use of an alternate downstream start codon, compared to variant 1. The resulting protein (isoform 4) has a distinct N-terminus and is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...