CLEC1 (CLEC1A) (NM_001297748) Human Untagged Clone
CAT#: SC334803
CLEC1A (untagged) - Human C-type lectin domain family 1, member A (CLEC1A), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
CLEC1A mouse monoclonal antibody,clone OTI1H8
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CLEC-1; CLEC1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001297748, the custom clone sequence may differ by one or more nucleotides
ATGCAGGCCAAGTACAGCAGCACGAGGGACATGCTGGATGATGATGGGGACACCACCATGAGCCTGCATT CTCAAGGCTCTGCCACAACTCGGCATCCAGAGCCCCGGCGCACAGTTTTTCAGTACTACCAGCTCTCCAA TACTGGTCAAGACACCATTTCTCAAATGGAAGAAAGATTAGGAAATACGTCCCAAGAGTTGCAATCTCTT CAAGTCCAGAATATAAAGCTTGCAGGAAGTCTGCAGCATGTGGCTGAAAAACTCTGTCGTGAGCTGTATA ACAAAGCTGGAGCACACAGGTGCAGCCCTTGTACAGAACAATGGAAATGGCATGGAGACAATTGCTACCA GTTCTATAAAGACAGCAAAAGTTGGGAGGACTGTAAATATTTCTGCCTTAGTGAAAACTCTACCATGCTG AAGATAAACAAACAAGAAGACCTGGAATTTGCCGCGTCTCAGAGCTACTCTGAGTTTTTCTACTCTTATT GGACAGGGCTTTTGCGCCCTGACAGTGGCAAGGCCTGGCTGTGGATGGATGGAACCCCTTTCACTTCTGA ACTGTTCCATATTATAATAGATGTCACCAGCCCAAGAAGCAGAGACTGTGTGGCCATCCTTAATGGGATG ATCTTCTCAAAGGACTGCAAAGAATTGAAGCGTTGTGTCTGTGAGAGAAGGGCAGGAATGGTGAAGCCAG AGAGCCTCCATGTCCCCCCTGAAACATTAGGCGAAGGTGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297748 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001297748.1, NP_001284677.1 |
RefSeq Size | 2682 bp |
RefSeq ORF | 744 bp |
Locus ID | 51267 |
UniProt ID | Q8NC01 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The encoded protein may play a role in regulating dendritic cell function. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...