Regucalcin (RGN) (NM_001282848) Human Untagged Clone

CAT#: SC334793

RGN (untagged) - Human regucalcin (RGN), transcript variant 3



  "NM_001282848" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RGN rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GNL; HEL-S-41; RC; SMP30
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282848, the custom clone sequence may differ by one or more nucleotides


ATGGATGCCCCAGTCAGCTCCGTGGCTCTTCGCCAGTCGGGAGGCTATGTTGCCACCATTGGAACAAAGT
TCTGTGCTTTGAACTGGAAAGAACAATCAGCAGTTGTCTTGGCCACGGTGGATAACGACAAGAAAAACAA
TCGCTTCAATGATGGGAAGGTGGATCCCGCCGGGAGGTACTTTGCTGGCACCATGGCTGAGGAAACAGCT
CCAGCAGTTCTTGAGCGGCACCAGGGGGCCCTGTACTCCCTCTTTCCTGATCACCACGTGAAAAAGTACT
TTGACCAGGTGGACATTTCCAATGGTTTGGATTGGTCGCTAGACCACAAAATCTTCTATTACATTGACAG
CCTGTCCTACTCCGTGGATGCCTTTGACTATGACCTGCAGACAGGACAGATCTCCAACCGCAGAAGTGTT
TACAAGCTAGAAAAGGAAGAACAAATCCCAGATGGAATGTGTATTGATGCTGAGGGGAAGCTCTGGGTGG
CCTGTTACAATGGAGGAAGAGTGATTCGTTTAGATCCTGTGACAGGGAAAAGACTTCAAACTGTGAAGTT
GCCTGTTGATAAAACAACTTCATGCTGCTTTGGAGGGAAGAATTACTCTGAAATGTATGTGACCTGCGCC
CGGGATGGGATGGACCCCGAGGGTCTTTTGAGGCAACCTGAAGCTGGTGGAATTTTCAAGATAACTGGTC
TGGGGGTCAAAGGAATTGCTCCCTACTCCTATGCGGGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001282848
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282848.1, NP_001269777.1
RefSeq Size 2208 bp
RefSeq ORF 741 bp
Locus ID 9104
UniProt ID Q15493
Gene Summary The protein encoded by this gene is a highly conserved, calcium-binding protein, that is preferentially expressed in the liver and kidney. It may have an important role in calcium homeostasis. Studies in rat indicate that this protein may also play a role in aging, as it shows age-associated down-regulation. This gene is part of a gene cluster on chromosome Xp11.3-Xp11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' coding region and initiates translation at a downstream start codon, compared to variant 2. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...