ERCC8 (NM_001290285) Human Untagged Clone

CAT#: SC334770

ERCC8 (untagged) - Human excision repair cross-complementation group 8 (ERCC8), transcript variant 4



  "NM_001290285" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ERCC8 mouse monoclonal antibody, clone OTI2G1 (formerly 2G1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CKN1; CSA; UVSS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290285, the custom clone sequence may differ by one or more nucleotides


ATGGGATACAAATACATTACAATTGGTACTAGAGGACCCAAAGTACAACTTTGTGACTTGAAGTCTGGAT
CCTGTTCTCACATTCTACAGGGTCACAGACAAGAAATATTAGCAGTTTCCTGGTCTCCACGTTATGACTA
TATCTTGGCAACAGCAAGTGCTGACAGTAGAGTAAAATTATGGGATGTGAGAAGAGCATCAGGATGTTTG
ATTACTCTTGATCAACATAATGGGAAAAAGTCACAAGCTGTTGAATCAGCAAACACTGCTCATAATGGGA
AAGTTAATGGCTTATGTTTTACAAGTGATGGACTTCACCTCCTCACTGTTGGTACAGATAATCGAATGAG
GCTCTGGAATAGTTCCAATGGAGAAAACACACTTGTGAACTATGGAAAAGTTTGTAATAACAGTAAAAAA
GGATTGAAATTCACTGTCTCCTGTGGCTGCAGTTCAGAATTTGTTTTTGTACCATATGGTAGCACCATTG
CTGTTTATACAGTTTACTCAGGAGAACAGATAACTATGCTTAAGGGACATTATAAAACTGTTGACTGCTG
TGTATTTCAGTCAAATTTCCAGGAACTTTATAGTGGTAGCAGAGACTGCAACATTCTGGCTTGGGTTCCA
TCCTTATATGAACCAGTTCCTGATGATGATGAGACTACAACAAAATCACAATTAAATCCGGCCTTTGAAG
ATGCCTGGAGCAGCAGTGATGAAGAAGGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001290285
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290285.1, NP_001277214.1
RefSeq Size 1962 bp
RefSeq ORF 732 bp
Locus ID 1161
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Nucleotide excision repair, Ubiquitin mediated proteolysis
Gene Summary This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (4) lacks an alternate internal exon and uses a downstream AUG start codon compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...