BCL7C (NM_001286526) Human Untagged Clone

CAT#: SC334763

BCL7C (untagged) - Human B-cell CLL/lymphoma 7C (BCL7C), transcript variant 1



  "NM_001286526" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal BCL7C Antibody
    • 100 ul

CNY 4,323.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286526, the custom clone sequence may differ by one or more nucleotides


ATGGCCGGCCGGACTGTACGGGCCGAGACCCGGAGCCGGGCCAAGGATGACATCAAGAAGGTGATGGCGA
CCATCGAGAAGGTCCGGAGATGGGAGAAGCGATGGGTGACTGTGGGCGACACTTCCCTTCGTATCTTCAA
GTGGGTGCCAGTGGTGGATCCCCAGGAGGAGGAGCGAAGGCGGGCAGGTGGCGGGGCAGAGAGATCCCGT
GGCCGGGAACGTCGGGGCAGGGGCGCCAGTCCCCGAGGGGGTGGCCCTCTCATCCTGCTGGATCTTAATG
ATGAGAACAGCAACCAGAGTTTCCATTCGGAAGGTTCCCTGCAAAAGGGCACAGAGCCCAGTCCTGGGGG
CACCCCCCAGCCCAGCCGCCCTGTGTCACCTGCCGGACCCCCAGAAGGGGTCCCTGAGGAGGCTCAGCCC
CCACGGCTGGGCCAAGAGAGAGATCCCGGGGGCATAACTGCTGGCAGCACCGACGAACCCCCAATGCTGA
CCAAGGAGGAGCCTGTTCCAGAACTGCTGGAAGCTGAGGATTCGGGAGTGAGAATGACGAGGAGAGCCCT
TCACGAGAAGGGGCTGAAGACAGAGCCCCTCAGGAGGCTCCTGCCCAGGAGGGGCCTCCGGACAAATGTC
CGGCCCAGTTCCATGGCGGTGCCGGACACCAGAGCTCCCGGGGGAGGCAGCAAGGCCCCGAGGGCACCCA
GAACAATCCCCCAGGGTAAGGGGAGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001286526
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286526.1, NP_001273455.1
RefSeq Size 1998 bp
RefSeq ORF 729 bp
Locus ID 9274
UniProt ID Q8WUZ0
Gene Summary This gene is identified by the similarity of its product to the N-terminal region of BCL7A protein. The BCL7A protein is encoded by the gene known to be directly involved in a three-way gene translocation in a Burkitt lymphoma cell line. The function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...