ING2 (NM_001291959) Human Untagged Clone

CAT#: SC334739

ING2 (untagged) - Human inhibitor of growth family, member 2 (ING2), transcript variant 2



  "NM_001291959" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ING2 mouse monoclonal antibody, clone OTI3B11 (formerly 3B11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ING1L; p33ING2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291959, the custom clone sequence may differ by one or more nucleotides


ATGGATCAGGACGGCGATCAGCAGCTCGGACCGTCGCGGATCCTGGCTCCGCAAACGTTAAAGGAAATTG
ATGATGTCTACGAAAAATATAAGAAAGAAGATGATTTAAACCAGAAGAAACGTCTACAGCAGCTTCTCCA
GAGAGCACTAATTAATAGTCAAGAATTGGGAGATGAAAAAATACAGATTGTTACACAAATGCTCGAATTG
GTGGAAAATCGGGCAAGACAAATGGAGTTACACTCACAGTGTTTCCAAGATCCTGCTGAAAGTGAACGAG
CCTCAGATAAAGCAAAGATGGATTCCAGCCAACCAGAAAGATCTTCAAGAAGACCCCGCAGGCAGCGGAC
CAGTGAAAGCCGTGATTTATGTCACATGGCAAATGGGATTGAAGACTGTGATGATCAGCCACCTAAAGAA
AAGAAATCCAAGTCAGCAAAGAAAAAGAAACGCTCCAAGGCCAAGCAGGAAAGGGAAGCTTCACCTGTTG
AGTTTGCAATAGATCCTAATGAACCTACATACTGCTTATGCAACCAAGTGTCTTATGGGGAGATGATAGG
ATGTGACAATGAACAGTGTCCAATTGAATGGTTTCACTTTTCATGTGTTTCACTTACCTATAAACCAAAG
GGGAAATGGTATTGCCCAAAGTGCAGGGGAGATAATGAGAAAACAATGGACAAAAGTACTGAAAAGACAA
AAAAGGATAGAAGATCGAGGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001291959
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291959.1, NP_001278888.1
RefSeq Size 2384 bp
RefSeq ORF 723 bp
Locus ID 3622
UniProt ID Q9H160
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon, resulting in translation initiation from an alternate start codon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...