CRF1 (CRHR1) (NM_001303018) Human Untagged Clone

CAT#: SC334737

CRHR1 (untagged) - Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1e



  "NM_001303018" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CRHR1 Antibody (N-Terminus)
    • 50 ug

CNY 5,654.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRF-R; CRF-R-1; CRF-R1; CRF1; CRFR-1; CRFR1; CRH-R-1; CRH-R1; CRHR; CRHR1L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001303018, the custom clone sequence may differ by one or more nucleotides


ATGAGCCCCGAGGTCCACCAGAGCAACGTGGGCTGGTGCAGGTTGGTGACAGCCGCCTACAACTACTTCC
ATGTGACCAACTTCTTCTGGATGTTCGGCGAGGGCTGCTACCTGCACACAGCCATCGTGCTCACCTACTC
CACTGACCGGCTGCGCAAATGGATGTTCATCTGCATTGGCTGGGGTGTGCCCTTCCCCATCATTGTGGCC
TGGGCCATTGGGAAGCTGTACTACGACAATGAGAAGTGCTGGTTTGGCAAAAGGCCTGGGGTGTACACCG
ACTACATCTACCAGGGCCCCATGATCCTGGTCCTGCTGATCAATTTCATCTTCCTTTTCAACATCGTCCG
CATCCTCATGACCAAGCTCCGGGCATCCACCACGTCTGAGACCATTCAGTACAGGAAGGCTGTGAAAGCC
ACTCTGGTGCTGCTGCCCCTCCTGGGCATCACCTACATGCTGTTCTTCGTCAATCCCGGGGAGGATGAGG
TCTCCCGGGTCGTCTTCATCTACTTCAACTCCTTCCTGGAATCCTTCCAGGGCTTCTTTGTGTCTGTGTT
CTACTGTTTCCTCAATAGTGAGGTCCGTTCTGCCATCCGGAAGAGGTGGCACCGGTGGCAGGACAAGCAC
TCGATCCGTGCCCGAGTGGCCCGTGCCATGTCCATCCCCACCTCCCCAACCCGTGTCAGCTTTCACAGCA
TCAAGCAGTCCACAGCAGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001303018
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001303018.1, NP_001289947.1
RefSeq Size 2388 bp
RefSeq ORF 723 bp
Locus ID 1394
UniProt ID P34998
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Long-term depression, Neuroactive ligand-receptor interaction
Gene Summary This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants. Naturally-occurring readthrough transcription between this gene and upstream GeneID:147081 results in transcripts that encode isoforms that share similarity with the products of this gene. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1e, also known as CRH-R1e) lacks three alternate exons, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1b. The encoded isoform (1e-B) is shorter at the N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...