GNB1 (NM_001282538) Human Untagged Clone
CAT#: SC334733
GNB1 (untagged) - Human guanine nucleotide binding protein (G protein), beta polypeptide 1 (GNB1), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MDS; MRD42 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282538, the custom clone sequence may differ by one or more nucleotides
ATGACCTGTGCATATGCCCCTTCTGGGAACTATGTGGCCTGCGGTGGCCTGGATAACATTTGCTCCATTT ACAATCTGAAAACTCGTGAGGGGAACGTGCGCGTGAGTCGTGAGCTGGCAGGACACACAGGTTACCTGTC CTGCTGCCGATTCCTGGATGACAATCAGATCGTCACCAGCTCTGGAGACACCACGTGTGCCCTGTGGGAC ATCGAGACCGGCCAGCAGACGACCACGTTTACCGGACACACTGGAGATGTCATGAGCCTTTCTCTTGCTC CTGACACCAGACTGTTCGTCTCTGGTGCTTGTGATGCTTCAGCCAAACTCTGGGATGTGCGAGAAGGCAT GTGCCGGCAGACCTTCACTGGCCACGAGTCTGACATCAATGCCATTTGCTTCTTTCCAAATGGCAATGCA TTTGCCACTGGCTCAGACGACGCCACCTGCAGGCTGTTTGACCTTCGTGCTGACCAGGAGCTCATGACTT ACTCCCATGACAACATCATCTGCGGGATCACCTCTGTCTCCTTCTCCAAGAGCGGGCGCCTCCTCCTTGC TGGGTACGACGACTTCAACTGCAACGTCTGGGATGCACTCAAAGCCGACCGGGCAGGTGTCTTGGCTGGG CATGACAACCGCGTCAGCTGCCTGGGCGTGACTGACGATGGCATGGCTGTGGCGACAGGGTCCTGGGATA GCTTCCTCAAGATCTGGAACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282538 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282538.1, NP_001269467.1 |
RefSeq Size | 3054 bp |
RefSeq ORF | 723 bp |
Locus ID | 2782 |
UniProt ID | P62873 |
Protein Pathways | Chemokine signaling pathway, Taste transduction |
Gene Summary | Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (3) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236839 | GNB1 (myc-DDK-tagged) - Human guanine nucleotide binding protein (G protein), beta polypeptide 1 (GNB1), transcript variant 3 |
CNY 3,990.00 |
|
RG236839 | GNB1 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), beta polypeptide 1 (GNB1), transcript variant 3 |
CNY 4,370.00 |