Ceramide synthase 1 (CERS1) (NM_001290265) Human Untagged Clone

CAT#: SC334722

CERS1 (untagged) - Human ceramide synthase 1 (CERS1), transcript variant 3



  "NM_001290265" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CERS1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EPM8; GDF-1; GDF1; LAG1; LASS1; UOG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290265, the custom clone sequence may differ by one or more nucleotides


ATGCCCGAGAGCGCTTGGAAGTTTCTCTTCTACCTGGGCAGCTGGAGCTACAGTGCCTACCTGCTGTTTG
GCACCGACTACCCCTTCTTCCATGACCCACCATCTGTCTTCTACGACTGGACGCCGGGCATGGCAGTGCC
ACGGGACATTGCAGCCGCCTACCTGCTCCAGGGAAGCTTCTATGGCCACTCCATCTACGCTACGCTATAC
ATGGACACCTGGCGCAAGGACTCGGTGGTCATGCTGCTCCACCACGTGGTCACTCTCATCCTCATCGTCT
CCTCCTACGCCTTCCGGTACCACAATGTGGGCATCCTTGTGCTCTTCCTGCACGATATCAGTGACGTGCA
GCTTGAGTTCACCAAGCTCAACATTTACTTCAAGTCCCGCGGCGGCTCCTACCATCGGCTGCATGCCTTG
GCAGCAGACTTGGGCTGCCTCAGCTTCGGCTTCAGCTGGTTCTGGTTCCGCCTCTACTGGTTCCCGCTCA
AGGTCCTGTATGCCACCAGTCACTGCAGTCTGCGCACGGTGCCTGACATCCCCTTCTACTTCTTCTTCAA
TGCGCTCCTGCTGCTGCTCACCCTTATGAACCTCTACTGGTTCCTGTACATCGTGGCGTTTGCAGCCAAG
GTGTTGACAGGCCAGGTGCACGAGCTGAAGGACCTGCGGGAGTATGACACAGCCGAGGCCCAGAGCCTGA
AGCCCAGCAAAGCCGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001290265
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290265.1, NP_001277194.1
RefSeq Size 1983 bp
RefSeq ORF 720 bp
Locus ID 10715
Protein Families Druggable Genome
Gene Summary This gene encodes a ceramide synthase enzyme, which catalyzes the synthesis of ceramide, the hydrophobic moiety of sphingolipids. The encoded enzyme synthesizes 18-carbon (C18) ceramide in brain neurons. Elevated expression of this gene may be associated with increased longevity, while decreased expression of this gene may be associated with myoclonus epilepsy with dementia in human patients. This protein is transcribed from a monocistronic mRNA as well as a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (3) is a monocistronic CERS1 transcript. Variant 3 represents the use of an alternate promoter and has multiple differences compared to variant 1, one of which results in a frameshift. Variant 3 encodes isoform 3 which has a shorter N-terminus and a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...