MTRF1L (NM_001301871) Human Untagged Clone
CAT#: SC334711
MTRF1L (untagged) - Human mitochondrial translational release factor 1-like (MTRF1L), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Anti-MTRF1L mouse monoclonal antibody, clone OTI2B5 (formerly 2B5)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HMRF1L; MRF1L; mtRF1a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301871, the custom clone sequence may differ by one or more nucleotides
ATGTTGTTTACATCAGAGATATTTGATATGTATCAGCAATATGCTGCATTTAAAAGATGGCATTTTGAAA CCCTGGAATATTTTCCAAGTGAACTAGGTGGCCTTAGACATGCATCTGCCAGCATTGGGGGTTCAGAAGC CTATAGGCACATGAAATTTGAAGGAGGTGTTCACAGAGTACAAAGAGTGCCAAAGACAGAAAAGCAAGGC CGCGTCCATACTAGCACCATGACTGTAGCAATATTACCCCAGCCTACTGAGATTAATCTGGTGATTAATC CGAAAGATTTGAGAATTGACACTAAGCGAGCCAGTGGAGCTGGGGGGCAGCATGTAAATACCACGGACAG TGCTGTCCGGATAGTTCATCTTCCAACAGGTGTTGTTTCTGAATGTCAACAAGAGAGATCTCAGCTGAAA AATAAAGAGCTGGCTATGACAAAGTTACGTGCAAAACTGTACAGCATGCATCTAGAAGAAGAAATAAATA AAAGACAGAATGCTAGAAAAATTCAGATTGGAAGTAAAGGAAGATCAGAGAAAATAAGAACATATAATTT TCCACAGAACCGGGTCACAGATCACAGAATAAACAAGACGCTGCATGATCTTGAAACTTTTATGCAAGGA GATTATCTACTGGATGAACTTGTACAGTCATTGAAGGAATACGCCGATTATGAATCTTTAGTAGAAATTA TTTCCCAAAAAGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301871 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301871.1, NP_001288800.1 |
RefSeq Size | 3790 bp |
RefSeq ORF | 717 bp |
Locus ID | 54516 |
UniProt ID | Q9UGC7 |
Gene Summary | The protein encoded by this gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. This protein acts upon UAA and UAG stop codons, but has no in vitro activity against UGA, which encodes tryptophan in human mitochondrion, or, the mitochondrial non-cognate stop codons, AGA and AGG. This protein shares sequence similarity to bacterial release factors. Pseudogenes of this gene are found on chromosomes 4, 8, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' coding region and uses a downstream start codon compared to variant 1. This variant encodes isoform 4, which has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...