RFXANK (NM_001278728) Human Untagged Clone

CAT#: SC334704

RFXANK (untagged) - Human regulatory factor X-associated ankyrin-containing protein (RFXANK), transcript variant 4



  "NM_001278728" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RFXANK mouse monoclonal antibody, clone OTI3E7 (formerly 3E7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ANKRA1; BLS; F14150_1; RFX-B
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278728, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTTACCCAGCCTGCAGAAGACCTCATCCAGACCCAGCAGACCCCTGCCTCAGAACTTGGGGACC
CTGAAGACCCCGGAGAGGAGGCTGCAGATGGCTCAGACACTGTGGTCCTCAGTCTCTTTCCCTGCACCCC
TGAGCCTGTGAATCCTGAACCGGATGCCAGTGTTTCCTCTCCACAGGGCAGCTCCCTGAAGCACTCCACC
ACTCTCACCAACCGGCAGCGAGGGAACGAGGTGTCAGCTCTGCCGGCCACCCTAGACTGTGACAACCTCG
TCAACAAGCCAGACGAGCGCGGCTTCACCCCCCTCATCTGGGCCTCCGCCTTTGGAGAGATTGAGACCGT
TCGCTTCCTGCTGGAGTGGGGTGCCGACCCCCACATCCTGGCAAAAGAGCGAGAGAGCGCCCTGTCGCTG
GCCAGCACAGGCGGCTACACAGACATTGTGGGGCTGCTGCTGGAGCGTGACGTGGACATCAACATCTATG
ATTGGAATGGAGGGACGCCACTGCTGTACGCTGTGCGCGGGAACCACGTGAAATGCGTTGAGGCCTTGCT
GGCCCGAGGCGCTGACCTCACCACCGAAGCCGACTCTGGCTACACCCCGATGGACCTTGCCGTGGCCCTG
GGATACCGGAAAGTGCAACAGGTGATCGAGAACCACATCCTCAAGCTCTTCCAGAGCAACCTGGTGCCCG
CTGACCCTGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278728
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278728.1, NP_001265657.1
RefSeq Size 1224 bp
RefSeq ORF 714 bp
Locus ID 8625
UniProt ID O14593
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Antigen processing and presentation, Primary immunodeficiency
Gene Summary Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (4) differs in the 5' UTR, and has an alternate splice site and lacks an in-frame exon in the coding region, as compared to variant 1. The resulting isoform (b) lacks an internal single aa and an internal segment, as compared to isoform a. Variants 2 and 4 encode the same isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...