RAB23 (NM_001278667) Human Untagged Clone
CAT#: SC334702
RAB23 (untagged) - Human RAB23, member RAS oncogene family (RAB23), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
RAB23 mouse monoclonal antibody,clone OTI2A8
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HSPC137 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001278667, the custom clone sequence may differ by one or more nucleotides
ATGTTGGAGGAAGATATGGAAGTCGCCATAAAGATGGTGGTTGTAGGGAATGGAGCAGTTGGAAAATCAA GTATGATTCAGCGATATTGCAAAGGCATTTTTACAAAAGACTACAAGAAAACCATTGGAGTTGATTTTTT GGAGCGACAAATTCAAGTTAATGATGAAGATGTCAGACTAATGTTATGGGACACTGCAGGTCAGGAGGAA TTTGATGCAATTACAAAGGCCTACTATCGAGGAGCCCAGGCTTGTGTGCTCGTGTTCTCTACCACAGATA GGGAATCTTTTGAAGCAGTTTCCAGTTGGAGAGAGAAAGTAGTAGCCGAAGTGGGAGATATACCAACTGT ACTTGTGCAAAACAAGATTGATCTTCTGGATGATTCTTGTATAAAGAATGAGGAAGCTGAGGCACTGGCA AAAAGGTTAAAGTTAAGATTCTACAGAACATCAGTGAAAGAAGATCTAAATGTGAATGAAGTTTTTAAGT ATTTGGCTGAAAAATACCTTCAGAAACTCAAACAACAAATAGCTGAGGATCCAGAACTAACGCATTCAAG TAGTAACAAGATTGGTGTCTTTAATACATCTGGTGGAAGTCACTCCGGTCAGAATTCAGGTACCCTCAAT GGTGGAGATGTCATCAATCTTAGACCCAACAAACAAAGGACCAAGAAAAACAGAAATCCTTTTAGCAGCT GTAGCATACCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278667 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278667.1, NP_001265596.1 |
RefSeq Size | 4540 bp |
RefSeq ORF | 714 bp |
Locus ID | 51715 |
UniProt ID | Q9ULC3 |
Protein Families | Druggable Genome |
Protein Pathways | Hedgehog signaling pathway |
Gene Summary | This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...